CRABP2 (NM_001199723) Human Untagged Clone

CAT#: SC329550

CRABP2 (untagged) - Homo sapiens cellular retinoic acid binding protein 2 (CRABP2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRABP2
• Synonyms: CRABP-II; RBP6
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199723, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCAACTTCTCTGGCAACTGGAAAATCATCCGATCGGAAAACTTCGAGGAATTGCTCAAAGTGCTGG
  GGGTGAATGTGATGCTGAGGAAGATTGCTGTGGCTGCAGCGTCCAAGCCAGCAGTGGAGATCAAACAGGA
  GGGAGACACTTTCTACATCAAAACCTCCACCACCGTGCGCACCACAGAGATTAACTTCAAGGTTGGGGAG
  GAGTTTGAGGAGCAGACTGTGGATGGGAGGCCCTGTAAGAGCCTGGTGAAATGGGAGAGTGAGAATAAAA
  TGGTCTGTGAGCAGAAGCTCCTGAAGGGAGAGGGCCCCAAGACCTCGTGGACCAGAGAACTGACCAACGA
  TGGGGAACTGATCCTGACCATGACGGCGGATGACGTTGTGTGCACCAGGGTCTACGTCCGAGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199723
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199723.1, NP_001186652.1
• RefSeq Size: 1075 bp
• RefSeq ORF: 417 bp
• Locus ID: 1382
• Cytogenetics: 1q23.1
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene encodes a member of the retinoic acid (RA, a form of vitamin A) binding protein family and lipocalin/cytosolic fatty-acid binding protein family. The protein is a cytosol-to-nuclear shuttling protein, which facilitates RA binding to its cognate receptor complex and transfer to the nucleus. It is involved in the retinoid signaling pathway, and is associated with increased circulating low-density lipoprotein cholesterol. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2010]'
  Transcript Variant: This variant (2) has an alternate 5' UTR and encodes the same protein, as compared to variant 1.