Methionine Sulfoxide Reductase A (MSRA) (NM_001199729) Human Untagged Clone

CAT#: SC329551

MSRA (untagged) - Homo sapiens methionine sulfoxide reductase A (MSRA), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MSRA
• Synonyms: PMSR
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199729, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAGTGTATT
  CAACTCAAGTTGGTTTTGCAGGAGGCTATACTTCAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAAC
  TGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTC
  TTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGG
  CCATCTACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCAAAAGGTTCT
  TTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACTTTCTACTATGCGGAAGAC
  TACCACCAGCAGTACCTGAGCAAGAACCCCAATGGCTACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCC
  CAGTGGGTATTAAAAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199729
• ORF Size: 510 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199729.1, NP_001186658.1
• RefSeq Size: 1716
• RefSeq ORF: 510
• Locus ID: 4482
• Gene Summary: This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
  Transcript Variant: This variant (4) contains alternate 5' exon structure, and it thus differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (d) is shorter at the N-terminus, compared to isoform a.