GADD45A (NM_001199742) Human Untagged Clone

CAT#: SC329553

GADD45A (untagged) - Homo sapiens growth arrest and DNA-damage-inducible, alpha (GADD45A), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GADD45A
• Synonyms: DDIT1; GADD45
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199742, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTTTGGAGGAATTCTCGGCTGGAGAGCAGAAGACCGAAAGGATGGATAAGGTGGGGGATGCCCTGG
  AGGAAGTGCTCAGCAAAGCCCTGAGTCAGCGCACGATCACTGTCGGGGTGTACGAAGCGGCCAAGCTGCT
  CAACGTAATCCACATTCATCTCAATGGAAGGATCCTGCCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199742
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199742.1, NP_001186671.1
• RefSeq Size: 1160 bp
• RefSeq ORF: 183 bp
• Locus ID: 1647
• Cytogenetics: 1p31.3
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• Protein Pathways: Cell cycle, MAPK signaling pathway, p53 signaling pathway
• Gene Summary: 'This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The DNA damage-induced transcription of this gene is mediated by both p53-dependent and -independent mechanisms. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Dec 2010]'
  Transcript Variant: This variant (3) lacks a coding exon, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1.