SH3 containing Grb 2 like 1 protein (SH3GL1) (NM_001199944) Human Untagged Clone

CAT#: SC329598

SH3GL1 (untagged) - Homo sapiens SH3-domain GRB2-like 1 (SH3GL1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SH3GL1
• Synonyms: CNSA1; EEN; SH3D2B; SH3P8
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199944, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGTGGCGGGGCTGAAGAAGCAGTTCTACAAGGCGAGCCAGCTGGTCAGTGAGAAGGTCGGAGGGG
  CCGAGGGGACCAAGCTGGATGATGACTTCAAAGAGATGGAGAAGAAGGTGGATGTCACCAGCAAGGCGGT
  GACAGAAGTGCTGGCCAGGACCATCGAGTACCTGCAGCCCAACCCAGCCTCGCGGGCTAAGCTGACCATG
  CTCAACACGGTGTCCAAGATCCGGGGCCAGAACCTGTGCGAGAAAGACCTGAAGGAGATCCAGCACCACC
  TGAAGAAACTGGAGGGCCGCCGCCTGGACTTTGACTACAAGAAGAAGCGGCAGGGCAAGATCCCCGATGA
  GGAGCTACGCCAGGCGCTGGAGAAGTTCGAGGAGTCCAAGGAGGTGGCAGAAACCAGCATGCACAACCTC
  CTGGAGACTGACATCGAGCAGGTGAGTCAGCTCTCGGCCCTGGTGGATGCACAGCTGGACTACCACCGGC
  AGGCCGTGCAGATCCTGGACGAGCTGGCGGAGAAGCTCAAGCGCAGGATGCGGGAAGCTTCCTCACGCCC
  TAAGCGGGAGTATAAGCCCAAGCCCCGGGAGCCCTTTGACCTTGGAGAGCCTGAGCAGTCCAACGGGGGC
  TTCCCCTGCACCACAGCCCCCAAGATCGCAGCTTCATCGTCTTTCCGATCTTCCGACAAGCCCATCCGGA
  CCCCTAGCCGGAGCATGCCGCCCCTGGACCAGCCGAGCTGCAAGGCGCTGTACGACTTCGAGCCCGAGAA
  CGACGGGGAGCTGGGCTTCCATGAGGGCGACGTCATCACGCTGACCAACCAGATCGATGAGAACTGGTAC
  GAGGGCATGCTGGACGGCCAGTCGGGCTTCTTCCCGCTCAGCTACGTGGAGGTGCTTGTGCCCCTGCCGC
  AGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199944
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199944.1, NP_001186873.1
• RefSeq Size: 2217 bp
• RefSeq ORF: 915 bp
• Locus ID: 6455
• Cytogenetics: 19p13.3
• Protein Families: Druggable Genome
• Protein Pathways: Endocytosis
• Gene Summary: 'This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]'
  Transcript Variant: This variant (3) uses two alternate in-frame splice sites in the coding region but maintains the reading frame, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.