ZNF 559 (ZNF559) (NM_001202411) Human Untagged Clone

CAT#: SC329647

ZNF559 (untagged) - Homo sapiens zinc finger protein 559 (ZNF559), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF559
• Synonyms: NBLA00121
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001202411, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGGCTGGGTGGTTGACAAATTACTCTCAGGACTCAGTGACCTTTGAGGATGTGGCTGTGGACTTCA
  CCCAGGAGGAGTGGACTTTGCTGGATCAAACTCAGAGAAACTTATACAGAGATGTGATGCTGGAGAACTA
  TAAGAATCTAGTTGCAGTAGATTGGGAGAGTCATATTAATACCAAATGGTCAGCACCTCAGCAGAATTTT
  TTGCAGGGGAAAACATCCAGTGTGGTGGAAATGAATTCAGAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001202411
• ORF Size: 255 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001202411.1, NP_001189340.1
• RefSeq Size: 3186
• RefSeq ORF: 255
• Locus ID: 84527
• Protein Families: Transcription Factors
• Gene Summary: May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (7) includes an additional exon in its 5' UTR, uses a downstream start codon, uses an alternate splice site that causes a frameshift in the 3' coding region, and differs in the 3' UTR, compared to variant 1. The encoded isoform (f) has a shorter N-terminus, a distinct C-terminus, and is overall shorter than isoform a. Variants 6, 7 and 8 all encode isoform f.