Vitamin D Binding protein (GC) (NM_001204307) Human Untagged Clone

CAT#: SC329736

GC (untagged) - Homo sapiens group-specific component (vitamin D binding protein) (GC), transcript variant 3


  "NM_001204307" in other vectors (2)

Reconstitution Protocol

USD 490.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GC
Synonyms DBP; DBP-maf; DBP/GC; Gc-MAF; GcMAF; GRD3; HEL-S-51; VDB; VDBG; VDBP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001204307, the custom clone sequence may differ by one or more nucleotides


ATGCTGTGGTCTTGGAGTGAGGAGAGAGGAGGTGCTGCAAGACTCTCTGGTAGAAAAATGAAGAGGGTCC
TGGTACTACTGCTTGCTGTGGCATTTGGACATGCTTTAGAGAGAGGCCGGGATTATGAAAAGAATAAAGT
CTGCAAGGAATTCTCCCATCTGGGAAAGGAGGACTTCACATCTCTGTCACTAGTCCTGTACAGTAGAAAA
TTTCCCAGTGGCACGTTTGAACAGGTCAGCCAACTTGTGAAGGAAGTTGTCTCCTTGACCGAAGCCTGCT
GTGCGGAAGGGGCTGACCCTGACTGCTATGACACCAGGACCTCAGCACTGTCTGCCAAGTCCTGTGAAAG
TAATTCTCCATTCCCCGTTCACCCAGGCACTGCTGAGTGCTGCACCAAAGAGGGCCTGGAACGAAAGCTC
TGCATGGCTGCTCTGAAACACCAGCCACAGGAATTCCCTACCTACGTGGAACCCACAAATGATGAAATCT
GTGAGGCGTTCAGGAAAGATCCAAAGGAATATGCTAATCAATTTATGTGGGAATATTCCACTAATTACGG
ACAAGCTCCTCTGTCACTTTTAGTCAGTTACACCAAGAGTTATCTTTCTATGGTAGGGTCCTGCTGTACC
TCTGCAAGCCCAACTGTATGCTTTTTGAAAGAGAGACTCCAGCTTAAACATTTATCACTTCTCACCACTC
TGTCAAATAGAGTCTGCTCACAATATGCTGCTTATGGGGAGAAGAAATCAAGGCTCAGCAATCTCATAAA
GTTAGCCCAAAAAGTGCCTACTGCTGATCTGGAGGATGTTTTGCCACTAGCTGAAGATATTACTAACATC
CTCTCCAAATGCTGTGAGTCTGCCTCTGAAGATTGCATGGCCAAAGAGCTGCCTGAACACACAGTAAAAC
TCTGTGACAATTTATCCACAAAGAATTCTAAGTTTGAAGACTGTTGTCAAGAAAAAACAGCCATGGACGT
TTTTGTGTGCACTTACTTCATGCCAGCTGCCCAACTCCCCGAGCTTCCAGATGTAGAGTTGCCCACAAAC
AAAGATGTGTGTGATCCAGGAAACACCAAAGTCATGGATAAGTATACATTTGAACTAAGCAGAAGGACTC
ATCTTCCGGAAGTATTCCTCAGTAAGGTACTTGAGCCAACCCTAAAAAGCCTTGGTGAATGCTGTGATGT
TGAAGACTCAACTACCTGTTTTAATGCTAAGGGCCCTCTACTAAAGAAGGAACTATCTTCTTTCATTGAC
AAGGGACAAGAACTATGTGCAGATTATTCAGAAAATACATTTACTGAGTACAAGAAAAAACTGGCAGAGC
GACTAAAAGCAAAATTGCCTGATGCCACACCCACGGAACTGGCAAAGCTGGTTAACAAGCACTCAGACTT
TGCCTCCAACTGCTGTTCCATAAACTCACCTCCTCTTTACTGTGATTCAGAGATTGATGCTGAATTGAAG
AATATCCTGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001204307
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204307.1, NP_001191236.1
RefSeq Size 1832 bp
RefSeq ORF 1482 bp
Locus ID 2638
Cytogenetics 4q13.3
Protein Families Secreted Protein
Gene Summary 'The protein encoded by this gene belongs to the albumin gene family. It is a multifunctional protein found in plasma, ascitic fluid, cerebrospinal fluid and on the surface of many cell types. It binds to vitamin D and its plasma metabolites and transports them to target tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]'
Transcript Variant: This variant (3) has an alternate 5' sequence which contains an upstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) has a longer N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.