SCNM1 (NM_001204856) Human Untagged Clone

CAT#: SC329770

SCNM1 (untagged) - Homo sapiens sodium channel modifier 1 (SCNM1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SCNM1
• Synonyms: MGC3180
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204856, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTTCGGGATGGACGCTTTGCTTGTGCCATCTGCCCCCATCGACCGGTACTGGACACCCTGGCCATGC
  TGACTGCCCACCGTGCAGGCAAGAAACATCTGTCCAGCTTGCAGCTTTTCTATGGCAAGAAGCAGCCGGG
  AAAGGAAAGAAAGCAGAATCCAAAACATCAGAATGAATTGAGAAGGGAAGAAACCAAAGCTGAGGCTCCT
  CTGCTAACTCAGACACGACTTATCACCCAGAGTGCTCTGCACAGAGCTCCCCACTATAACAGTTGCTGCC
  GCCGGAAGTACAGACCAGAAGCCCCTGGTCCCTCTGTCTCCCTTTCCCCTATGCCACCCTCAGAGGTCAA
  ACTCCAAAGTGGGAAGATCAGTAGGGAACCTGAACCTGCGGCTGGCCCACAGGCCGAGGAGTCAGCAACT
  GTCTCAGCCCCTGCACCCATGAGCCCCACAAGAAGACGAGCCCTGGACCATTATCTCACCCTTCGAAGCT
  CTGGATGGATCCCAGATGGACGAGGTCGATGGGTAAAAGATGAAAATGTTGAGTTTGACTCTGATGAGGA
  GGAACCACCTGATCTCCCCTTGGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204856
• ORF Size: 588 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001204856.1, NP_001191785.1
• RefSeq Size: 2085
• RefSeq ORF: 588
• Locus ID: 79005
• Gene Summary: SCNM1 is a zinc finger protein and putative splicing factor. In mice, Scnm1 modifies phenotypic expression of Scn8a (MIM 600702) mutations (Buchner et al., 2003 [PubMed 12920299]). [supplied by OMIM, Oct 2009]
  Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. These differences causes translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.