Transcription termination factor 1 (TTF1) (NM_001205296) Human Untagged Clone

CAT#: SC329802

TTF1 (untagged) - Homo sapiens transcription termination factor, RNA polymerase I (TTF1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TTF1
• Synonyms: TTF-1; TTF-I
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001205296, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACCGGGACGACTTGGAACGGTTTAAGGAATTTAAAGCACAAGGTGTCGCTATTAAATTTGGCAAGT
  TTTCTGTAAAGGAAAATAAGCAGTTAGAGAAAAATGTGGAAGACTTTCTAGCCCTGACAGGCATTGAGAG
  TGCAGACAAGCTGCTGTACACGGACAGATATCCTGAGGAAAAATCTGTGATCACCAACTTAAAAAGGAGA
  TACTCGTTTAGATTACACATTGGTAGGAACATTGCCCGGCCCTGGAAACTTATATACTATCGAGCAAAGA
  AGATGTTCGATGTCAACAATTACAAAGGCAGGTATAGCGAAGGAGATACTGAGAAGTTAAAGATGTACCA
  TTCTCTCCTTGGGAATGACTGGAAGACGATTGGTGAGATGGTGGCCCGAAGTAGCCTCTCCGTGGCCCTC
  AAGTTCTCACAGATCAGCAGTCAAAGAAATCGTGGTGCTTGGAGTAAGTCTGAAACCCGGAAACTAATCA
  AGGCTGTCGAAGAAGTGATTCTGAAGAAGATGTCTCCCCAGGAGTTAAAAGAGGTGGATTCCAAACTCCA
  AGAAAATCCTGAAAGTTGCCTATCAATTGTTCGGGAAAAACTCTACAAGGGCATATCTTGGGTAGAAGTA
  GAAGCTAAAGTGCAAACCAGAAATTGGATGCAGTGTAAAAGTAAGTGGACAGAAATTCTAACCAAGAGGA
  TGACTAATGGTCGGCGTATCTACTATGGCATGAATGCCCTGCGGGCCAAGGTCAGCCTTATTGAAAGGTT
  GTATGAAATAAATGTGGAAGATACTAATGAAATAGACTGGGAAGATCTTGCTAGTGCCATAGGTGATGTT
  CCTCCATCTTACGTTCAAACTAAATTTTCTAGGCTGAAAGCTGTCTATGTTCCATTTTGGCAGAAAAAGA
  CTTTTCCAGAGATCATCGACTACCTTTATGAGACGACTCTACCTTTGCTGAAGGAAAAGTTAGAAAAAAT
  GATGGAGAAAAAAGGCACTAAAATCCAGACTCCTGCAGCACCCAAGCAAGTTTTCCCATTTCGAGACATC
  TTTTATTATGAAGACGATAGTGAAGGAGAGGACATAGAAAAAGAAAGCGAAGGCCAGGCGCCATGCATGG
  CTCACGCCTGTAATTCCAGTACTTTGGGAGGCCAAGGCCGGTGGATCATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001205296
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001205296.1, NP_001192225.1
• RefSeq Size: 1780 bp
• RefSeq ORF: 1173 bp
• Locus ID: 7270
• Cytogenetics: 9q34.13
• Gene Summary: 'This gene encodes a transcription termination factor that is localized to the nucleolus and plays a critical role in ribosomal gene transcription. The encoded protein mediates the termination of RNA polymerase I transcription by binding to Sal box terminator elements downstream of pre-rRNA coding regions. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene shares the symbol/alias 'TFF1' with another gene, NK2 homeobox 1, also known as thyroid transcription factor 1, which plays a role in the regulation of thyroid-specific gene expression. [provided by RefSeq, Apr 2011]'
  Transcript Variant: This variant (2) lacks an exon in the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.