DHPS (NM_001206974) Human Untagged Clone

CAT#: SC329867

DHPS (untagged) - Homo sapiens deoxyhypusine synthase (DHPS), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DHPS
• Synonyms: DHS; DS; MIG13
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206974, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTATAATCCCAGCATTTTGGGAAGCCGAGGCGGGTGGATCAAGAGAAGAGGAGTTCGAGACAAGCC
  TGGCCAACATGATCGAGAAGAAGCTGGAACCACTGTCACAGGATGAAGACCAGCACGCGGACCTGACCCA
  GAGCCGCCGCCCACTTACCAGCTGCACCATTTTCCTGGGATATACATCCAACCTCATCAGTTCAGGCATC
  CGTGAGACCATTCGCTACCTTGTGCAGCACAACATGGTGGACGTATTGGTGACCACAGCTGGCGGCGTGG
  AGGAAGACCTCATCAAGTGCCTGGCGCCCACATACTTGGGCGAGTTTAGCCTCAGGGGGAAGGAGCTCCG
  GGAGAACGGGATCAATAGGATCGGAAACCTGCTGGTGCCCAATGAGAATTACTGCAAGTTTGAGGACTGG
  CTGATGCCCATTCTGGACCAGATGGTGATGGAGCAGAACACAGAGGGTGTAAAGTGGACGCCTTCTAAGA
  TGATCGCCCGGCTGGGCAAGGAGATCAACAACCCAGAGTCCGTGTATTACTGGGCCCAGAAGAACCACAT
  CCCTGTGTTTAGTCCCGCACTTACAGACGGCTCGCTGGGCGACATGATCTTCTTCCATTCCTACAAGAAC
  CCGGGCCTGGTCCTGGACATCGTTGAGGACCTGAGGCTCATCAACACACAGGCCATCTTTGCCAAGTGCA
  CTGGGATGATCATTCTGGGCGGGGGCGTGGTCAAGCACCACATTGCCAATGCCAACCTCATGCGGAACGG
  GGCCGACTACGCTGTTTACATCAACACAGCCCAGGAGTTTGATGGCTCTGACTCAGGTGCCCGACCAGAC
  GAGGCTGTCTCCTGGGGCAAGATCCGGGTGGATGCACAGCCCGTCAAGGTCTATGCTGACGCCTCCCTGG
  TCTTCCCCCTGCTTGTGGCTGAAACCTTTGCCCAGAAGATGGATGCCTTCATGCATGAGAAGAACGAGGA
  CTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206974
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206974.1, NP_001193903.1
• RefSeq Size: 1212 bp
• RefSeq ORF: 984 bp
• Locus ID: 1725
• Cytogenetics: 19p13.13
• Gene Summary: 'This gene encodes a protein that is required for the formation of hypusine, a unique amino acid formed by the posttranslational modification of only one protein, eukaryotic translation initiation factor 5A. The encoded protein catalyzes the first step in hypusine formation by transferring the butylamine moiety of spermidine to a specific lysine residue of the eukaryotic translation initiation factor 5A precursor, forming an intermediate deoxyhypusine residue. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2011]'
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.