PPP2R2C (NM_001206996) Human Untagged Clone

CAT#: SC329880

PPP2R2C (untagged) - Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP2R2C
• Synonyms: B55-GAMMA; B55gamma; IMYPNO; IMYPNO1; PR52; PR55G
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206996, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAAAGAGAGACACGGCTGACATCATCTCTACCGTTGAGTTCAACCACACGGGAGAGCTGCTGGCCA
  CAGGTGACAAGGGCGGCCGGGTCGTCATCTTCCAGCGGGAACCAGAGAGTAAAAATGCGCCCCACAGCCA
  GGGCGAATACGACGTGTACAGCACTTTCCAGAGCCACGAGCCGGAGTTTGACTATCTCAAGAGCCTGGAG
  ATAGAGGAGAAGATCAACAAGATCAAGTGGCTCCCACAGCAGAACGCCGCCCACTCACTCCTGTCCACCA
  ACGATAAAACTATCAAATTATGGAAGATTACCGAACGAGATAAAAGGCCCGAAGGATACAACCTGAAGGA
  TGAAGAGGGGAAACTTAAGGACCTGTCCACGGTGACGTCACTGCAGGTGCCAGTGCTGAAGCCCATGGAT
  CTGATGGTGGAGGTGAGCCCTCGGAGGATCTTTGCCAATGGCCACACCTACCACATCAACTCCATCTCCG
  TCAACAGTGACTGCGAGACCTACATGTCGGCGGATGACCTGCGCATCAACCTCTGGCACCTGGCCATCAC
  CGACAGGAGCTTCAACATCGTGGACATCAAGCCGGCCAACATGGAGGACCTTACGGAGGTGATCACAGCA
  TCTGAGTTCCATCCGCACCACTGCAACCTCTTCGTCTACAGCAGCAGCAAGGGCTCCCTGCGGCTCTGCG
  ACATGCGGGCAGCTGCCCTGTGTGACAAGCATTCCAAGCTCTTTGAAGAGCCTGAGGACCCCAGTAACCG
  CTCATTCTTCTCGGAAATCATCTCCTCCGTGTCCGACGTGAAGTTCAGCCACAGCGGCCGCTACATGCTC
  ACCCGGGACTACCTTACAGTCAAGGTCTGGGACCTGAACATGGAGGCAAGACCCATAGAGACCTACCAGG
  TCCATGACTACCTTCGGAGCAAGCTCTGTTCCCTGTACGAGAACGACTGCATTTTCGACAAGTTTGAATG
  TGCCTGGAACGGGAGCGACAGCGTCATCATGACCGGGGCCTACAACAACTTCTTCCGCATGTTCGATCGG
  AACACCAAGCGGGACGTGACCCTGGAGGCCTCGAGGGAAAGCAGCAAGCCCCGGGCTGTGCTCAAGCCAC
  GGCGCGTGTGCGTGGGGGGCAAGCGCCGGCGTGATGACATCAGTGTGGACAGCTTGGACTTCACCAAGAA
  GATCCTGCACACGGCCTGGCACCCGGCTGAGAACATCATTGCCATCGCCGCCACCAACAACCTGTACATC
  TTCCAGGACAAGGTAAACTCTGACATGCACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206996
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206996.1, NP_001193925.1
• RefSeq Size: 4315 bp
• RefSeq ORF: 1293 bp
• Locus ID: 5522
• Cytogenetics: 4p16.1
• Protein Families: Druggable Genome, Phosphatase
• Protein Pathways: Tight junction
• Gene Summary: 'The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (5) contains alternate 5' exon structure, and it thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.