ETV7 (NM_001207036) Human Untagged Clone

CAT#: SC329887

ETV7 (untagged) - Homo sapiens ets variant 7 (ETV7), transcript variant 3


  "NM_001207036" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ETV7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ETV7
Synonyms TEL-2; TEL2; TELB
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001207036, the custom clone sequence may differ by one or more nucleotides


ATGCAGGAGGGAGAATTGGCTATTTCTCCTATAAGCCCTGTGGCAGCCATGCCTCCCCTAGGCACCCACG
TGCAAGCCAGATGTGAAGCTCAAATTAACCTGCTGGGTGAAGGGGGGATCTGCAAGCTGCCAGGAAGACT
CCGTGACGTCCTGTATGAGCTGCTCCAGTACATCAAGACCCAGCGGCGAGCCCTGGTGTGTGGGCCCTTT
TTTGGAGGGATCTTCAGGCTGAAGACGCCCACCCAGCACTCTCCAGTCCCCCCGGAAGAGGTGACTGGCC
CCTCTCAGATGGACACCCGAAGGGGCCACCTGCTGCAGCCACCAGACCCAGGGCTTACCAGCAACTTCGG
CCACCTGGATGACCCTGGCCTGGCAAGGTGGACCCCTGGCAAGGAGGAGTCCCTCAACTTATGTCACTGT
GCAGAGCTCGGCTGCAGGACCCAGGGGGTCTGTTCCTTCCCCGCGATGCCGCAGGCCCCCATTGACGGCA
GGATCGCTGACTGCCGCCTGCTGTGGGATTACGTGTATCAGCTGCTCCTTGATACCCGATATGAGCCCTA
CATCAAGTGGGAAGACAAGGACGCCAAGATCTTCCGAGTTGTGGATCCAAATGGGCTCGCCAGACTCTGG
GGAAATCACAAGAACCGGGTGAACATGACCTACGAGAAGATGTCTCGTGCCCTGCGCCACTATTATAAGC
TTAATATCATTAAGAAGGAACCGGGGCAGAAACTCCTGTTCAGATTTCTAAAGACTCCGGGAAAGATGGT
CCAGGACAAGCACAGCCACCTGGAGCCGCTGGAGAGCCAGGAGCAGGACAGAATAGAGTTCAAGGACAAG
AGGCCAGAAATCTCTCCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001207036
ORF Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001207036.1, NP_001193965.1
RefSeq Size 1596
RefSeq ORF 861
Locus ID 51513
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Dorso-ventral axis formation
Gene Summary The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721). [provided by RefSeq, May 2011]
Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (3, also known as Tel-2d) missing an internal protein segment compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.