ETV7 (NM_001207037) Human Untagged Clone

CAT#: SC329888

ETV7 (untagged) - Homo sapiens ets variant 7 (ETV7), transcript variant 4


  "NM_001207037" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ETV7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ETV7
Synonyms TEL-2; TEL2; TELB
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001207037, the custom clone sequence may differ by one or more nucleotides


ATGCACCGCGGAGCACGGGTTCGAGATGAACGGACGCGCCCTCTGCATCCTCACCAAGGACGACTTCCGG
CACCGTGCGCCCAGCTCAGGTCAGGGAAACGCACAGGCTTTCCTCTAAGCGGGAACCCTGGTGACGTCCT
GTATGAGCTGCTCCAGTACATCAAGACCCAGCGGCGAGCCCTGGTGTGTGGGCCCTTTTTTGGAGGGATC
TTCAGGCTGAAGACGCCCACCCAGCACTCTCCAGTCCCCCCGGAAGAGGTGACTGGCCCCTCTCAGATGG
ACACCCGAAGGGGCCACCTGCTGCAGCCACCAGACCCAGGGCTTACCAGCAACTTCGGCCACCTGGATGA
CCCTGGCCTGGCAAGGTGGACCCCTGGCAAGGAGGAGTCCCTCAACTTATGTCACTGTGCAGAGCTCGGC
TGCAGGACCCAGGGGGTCTGTTCCTTCCCCGCGATGCCGCAGGCCCCCATTGACGGCAGGATCGCTGACT
GCCGCCTGCTGTGGGATTACGTGTATCAGCTGCTCCTTGATACCCGATATGAGCCCTACATCAAGTGGGA
AGACAAGGACGCCAAGATCTTCCGAGTTGTGGATCCAAATGGGCTCGCCAGACTCTGGGGAAATCACAAG
AACCGGGTGAACATGACCTACGAGAAGATGTCTCGTGCCCTGCGCCACTATTATAAGCTTAATATCATTA
AGAAGGAACCGGGGCAGAAACTCCTGTTCAGATTTCTAAAGACTCCGGGAAAGATGGTCCAGGACAAGCA
CAGCCACCTGGAGCCGCTGGAGAGCCAGGAGCAGGACAGAATAGAGTTCAAGGACAAGAGGCCAGAAATC
TCTCCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001207037
ORF Size 849 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001207037.1, NP_001193966.1
RefSeq Size 1802
RefSeq ORF 849
Locus ID 51513
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Dorso-ventral axis formation
Gene Summary The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721). [provided by RefSeq, May 2011]
Transcript Variant: This variant (4) uses an alternate donor splice site at an internal exon compared to variant 1. This results in the creation of an upstream ORF (uORF), translation of which will render this transcript a candidate for nonsense-mediated mRNA decay (NMD). However, since the uORF has a weak Kozak signal, translation from a downstream AUG is possible by leaky scanning, resulting in an isoform (4, also known as Tel-2a) with a distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.