ETV7 (NM_001207040) Human Untagged Clone
CAT#: SC329891
ETV7 (untagged) - Homo sapiens ets variant 7 (ETV7), transcript variant 7
"NM_001207040" in other vectors (2)
Product Images
Other products for "ETV7"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ETV7 |
Synonyms | TEL-2; TEL2; TELB |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001207040, the custom clone sequence may differ by one or more nucleotides
ATGAACGGACGCGCCCTCTGCATCCTCACCAAGGACGACTTCCGGCACCGTGCGCCCAGCTCAGGTGACG TCCTGTATGAGCTGCTCCAGTACATCAAGACCCAGCGGCGAGCCCTGGTGTGTGGGCCCTTTTTTGGAGG GATCTTCAGGCTGAAGACGCCCACCCAGCACTCTCCAGTCCCCCCGGAAGAGGTGACTGGCCCCTCTCAG ATGGACACCCGAAGGGGCCACCTGCTGCAGCCACCAGACCCAGGGCTTACCAGCAACTTCGGCCACCTGG ATGACCCTGGCCTGGCAAGGTGGACCCCTGGCAAGGAGGAGTCCCTCAACTTATGTCACTGTGCAGAGCT CGGCTGCAGGACCCAGGGGGTCTGTTCCTTCCCCGCGATGCCGCAGGCCCCCATTGACGGCAGGATCGCT GACTGCCGCCTGCTGTGGGATTACGTGTATCAGCTGCTCCTTGATACCCGATATGAGCCCTACATCAAGT GGGAAGACAAGGACGCCAAGATCTTCCGAGTTGTGGATCCAAATGGGCTCGCCAGACTCTGGGGAAATCA CAAGAACCGGGTGAACATGACCTACGAGAAGATGTCTCGTGCCCTGCGCCACTATTATAAGCTTAATATC ATTAAGAAGGAACCGGGGCAGAAACTCCTGTTCAGATTTCTAAAGACTCCGGGAAAGATGGTCCAGGACA AGCACAGCCACCTGGAGCCGCTGGAGAGCCAGGAGCAGGACAGAATAGAGTTCAAGGACAAGAGGCCAGA AATCTCTCCGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001207040 |
ORF Size | 783 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001207040.1, NP_001193969.1 |
RefSeq Size | 1625 |
RefSeq ORF | 783 |
Locus ID | 51513 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Dorso-ventral axis formation |
Gene Summary | The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721). [provided by RefSeq, May 2011] Transcript Variant: This variant (7) lacks an exon in the 5' region compared to variant 1. This results in the creation of two upstream ORFs (uORFs), translation of which will render this transcript a candidate for nonsense-mediated mRNA decay (NMD). However, since both uORFs have weak Kozak signals, translation from an in-frame downstream AUG is possible by leaky scanning, resulting in an isoform (7, also known as Tel-2c) with a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.