ETV7 (NM_001207041) Human Untagged Clone

CAT#: SC329892

ETV7 (untagged) - Homo sapiens ets variant 7 (ETV7), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ETV7
• Synonyms: TEL-2; TEL2; TELB
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001207041, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACACCCGAAGGGGCCACCTGCTGCAGCCACCAGACCCAGGGCTTACCAGCAACTTCGGCCACCTGG
  ATGACCCTGGCCTGGCAAGGTGGACCCCTGGCAAGGAGGAGTCCCTCAACTTATGTCACTGTGCAGAGCT
  CGGCTGCAGGACCCAGGGGGTCTGTTCCTTCCCCGCGATGCCGCAGGCCCCCATTGACGGCAGGATCGCT
  GACTGCCGCCTGCTGTGGGATTACGTGTATCAGCTGCTCCTTGATACCCGATATGAGCCCTACATCAAGT
  GGGAAGACAAGGACGCCAAGATCTTCCGAGTTGTGGATCCAAATGGGCTCGCCAGACTCTGGGGAAATCA
  CAAGAACCGGGTGAACATGACCTACGAGAAGATGTCTCGTGCCCTGCGCCACTATTATAAGCTTAATATC
  ATTAAGAAGGAACCGGGGCAGAAACTCCTGTTCAGATTTCTAAAGACTCCGGGAAAGATGGTCCAGGACA
  AGCACAGCCACCTGGAGCCGCTGGAGAGCCAGGAGCAGGACAGAATAGAGTTCAAGGACAAGAGGCCAGA
  AATCTCTCCGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001207041
• ORF Size: 573 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001207041.1, NP_001193970.1
• RefSeq Size: 1460
• RefSeq ORF: 573
• Locus ID: 51513
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Dorso-ventral axis formation
• Gene Summary: The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721). [provided by RefSeq, May 2011]
  Transcript Variant: This variant (8) lacks two consecutive coding exons compared to variant 1. This results in translation initiation from an in-frame downstream AUG, and an isoform (8) with a shorter N-terminus compared to isoform 1.