LHX6 (NM_001242335) Human Untagged Clone

CAT#: SC329928

LHX6 (untagged) - Homo sapiens LIM homeobox 6 (LHX6), transcript variant 5


  "NM_001242335" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LHX6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LHX6
Synonyms LHX6.1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001242335, the custom clone sequence may differ by one or more nucleotides


ATGATTGAGAACCTCAAGAGGGCCGCCGAGAACGGGAACGGCCTCACGTTGGAGGGGGCAGTGCCCTCGG
AACAGGACAGTCAACCCAAGCCGGCCAAGCGCGCGCGGACGTCCTTCACCGCGGAACAGCTGCAGGTTAT
GCAGGCGCAGTTCGCGCAGGACAACAACCCCGACGCTCAGACGCTGCAGAAGCTGGCGGACATGACGGGC
CTCAGCCGGAGAGTCATCCAGGTGTGGTTTCAAAACTGCCGGGCGCGTCATAAAAAGCACACGCCGCAAC
ACCCAGTGCCGCCCTCGGGGGCGCCCCCGTCCCGCCTTCCCTCCGCCCTGTCCGACGACATCCACTACAC
CCCGTTCAGCAGCCCCGAGCGGGCGCGCATGGTCACCCTGCACGGCTACATTGAGAGTCAGGTACAGTGC
GGGCAGGTGCACTGCCGGCTGCCTTACACCGCACCCCCCGTCCACCTCAAAGCCGATATGGATGGGCCGC
TCTCCAACCGGGGTGAGAAGGTCATCCTTTTTCAGTACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001242335
ORF Size 531 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001242335.1, NP_001229264.1
RefSeq Size 3603
RefSeq ORF 531
Locus ID 26468
Protein Families Transcription Factors
Gene Summary This gene encodes a member of a large protein family that contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein has tandem LIM domains as well as a DNA-binding homeodomain. The protein functions as a transcription factor involved in embryogenesis and head development and is highly expressed in neural crest derived mesenchyme cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (5) is shorter at the N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.