LHX6 (NM_001242335) Human Untagged Clone
CAT#: SC329928
LHX6 (untagged) - Homo sapiens LIM homeobox 6 (LHX6), transcript variant 5
"NM_001242335" in other vectors (2)
Product Images
Other products for "LHX6"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LHX6 |
Synonyms | LHX6.1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001242335, the custom clone sequence may differ by one or more nucleotides
ATGATTGAGAACCTCAAGAGGGCCGCCGAGAACGGGAACGGCCTCACGTTGGAGGGGGCAGTGCCCTCGG AACAGGACAGTCAACCCAAGCCGGCCAAGCGCGCGCGGACGTCCTTCACCGCGGAACAGCTGCAGGTTAT GCAGGCGCAGTTCGCGCAGGACAACAACCCCGACGCTCAGACGCTGCAGAAGCTGGCGGACATGACGGGC CTCAGCCGGAGAGTCATCCAGGTGTGGTTTCAAAACTGCCGGGCGCGTCATAAAAAGCACACGCCGCAAC ACCCAGTGCCGCCCTCGGGGGCGCCCCCGTCCCGCCTTCCCTCCGCCCTGTCCGACGACATCCACTACAC CCCGTTCAGCAGCCCCGAGCGGGCGCGCATGGTCACCCTGCACGGCTACATTGAGAGTCAGGTACAGTGC GGGCAGGTGCACTGCCGGCTGCCTTACACCGCACCCCCCGTCCACCTCAAAGCCGATATGGATGGGCCGC TCTCCAACCGGGGTGAGAAGGTCATCCTTTTTCAGTACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242335 |
ORF Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001242335.1, NP_001229264.1 |
RefSeq Size | 3603 |
RefSeq ORF | 531 |
Locus ID | 26468 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a member of a large protein family that contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein has tandem LIM domains as well as a DNA-binding homeodomain. The protein functions as a transcription factor involved in embryogenesis and head development and is highly expressed in neural crest derived mesenchyme cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017] Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (5) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.