Fbx32 (FBXO32) (NM_001242463) Human Untagged Clone
CAT#: SC329961
FBXO32 (untagged) - Homo sapiens F-box protein 32 (FBXO32), transcript variant 3
"NM_001242463" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "FBXO32"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FBXO32 |
Synonyms | Fbx32; MAFbx |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001242463, the custom clone sequence may differ by one or more nucleotides
ATGCCATTCCTCGGGCAGGACTGGCGGTCCCCCGGGCAGAACTGGGTGAAGACGGCCGACGGCTGGAAGC GCTTCCTGGATGAGAAGAGCGGCAGTTTCGTGAGCGACCTCAGCAGTTACTGCAACAAGGAGGTATACAA TAAGGAGAATCTTTTCAACAGCCTGAACTATGATGTTGCAGCCAAGAAGAGAAAGAAGGACATGCTGAAT AGCAAAACCAAAACTCAGTATTTCCACCAAGAAAAATGGATCTATGTTCACAAAGGAAGTACTAAAGAGC GCCATGGATATTGCACCCTGGGGGAAGCTTTCAACAGACTGGACTTCTCAACTGCCATTCTGGATTCCAG AAGATTTAACTACGTGGTCCGGCCTGCCTTCAAAGGCCTCACCTTCACTGACCTGCCTTTGTGCCTACAA CTGAACATCATGCAGAGGCTGAGCGACGGGCGGGACCTGGTCAGCCTGGGCCAGGCTGCCCCCGACCTGC ACGTGCTCAGCGAAGACCGGCTGCTGTGGAAGAAACTCTGCCAGTACCACTTCTCCGAGCGGCAGATCCG CAAACGATTAATTCTGTCAGACAAAGGGCAGCTGGATTGGAAGAAGATGTATTTCAAACTTGTCCGATGT TACCCAAGGAAAGAGCAGTATGGAGATACCCTTCAGCTCTGCAAACACTGTCACATCCTTTCCTGGAAGG GCACTGACCATCCGTGCACTGCCAATAACCCAGAGAGCTGCTCCGTTTCACTTTCACCCCAGGACTTTAT CAACTTGTTCAAGTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242463 |
ORF Size | 789 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001242463.1, NP_001229392.1 |
RefSeq Size | 6521 |
RefSeq ORF | 789 |
Locus ID | 114907 |
Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and contains an F-box domain. This protein is highly expressed during muscle atrophy, whereas mice deficient in this gene were found to be resistant to atrophy. This protein is thus a potential drug target for the treatment of muscle atrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (3) lacks two in-frame exons in the coding region, compared to variant 1. This encodes a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.