Fbx32 (FBXO32) (NM_001242463) Human Untagged Clone

CAT#: SC329961

FBXO32 (untagged) - Homo sapiens F-box protein 32 (FBXO32), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FBXO32
• Synonyms: Fbx32; MAFbx
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242463, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCATTCCTCGGGCAGGACTGGCGGTCCCCCGGGCAGAACTGGGTGAAGACGGCCGACGGCTGGAAGC
  GCTTCCTGGATGAGAAGAGCGGCAGTTTCGTGAGCGACCTCAGCAGTTACTGCAACAAGGAGGTATACAA
  TAAGGAGAATCTTTTCAACAGCCTGAACTATGATGTTGCAGCCAAGAAGAGAAAGAAGGACATGCTGAAT
  AGCAAAACCAAAACTCAGTATTTCCACCAAGAAAAATGGATCTATGTTCACAAAGGAAGTACTAAAGAGC
  GCCATGGATATTGCACCCTGGGGGAAGCTTTCAACAGACTGGACTTCTCAACTGCCATTCTGGATTCCAG
  AAGATTTAACTACGTGGTCCGGCCTGCCTTCAAAGGCCTCACCTTCACTGACCTGCCTTTGTGCCTACAA
  CTGAACATCATGCAGAGGCTGAGCGACGGGCGGGACCTGGTCAGCCTGGGCCAGGCTGCCCCCGACCTGC
  ACGTGCTCAGCGAAGACCGGCTGCTGTGGAAGAAACTCTGCCAGTACCACTTCTCCGAGCGGCAGATCCG
  CAAACGATTAATTCTGTCAGACAAAGGGCAGCTGGATTGGAAGAAGATGTATTTCAAACTTGTCCGATGT
  TACCCAAGGAAAGAGCAGTATGGAGATACCCTTCAGCTCTGCAAACACTGTCACATCCTTTCCTGGAAGG
  GCACTGACCATCCGTGCACTGCCAATAACCCAGAGAGCTGCTCCGTTTCACTTTCACCCCAGGACTTTAT
  CAACTTGTTCAAGTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242463
• ORF Size: 789 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001242463.1, NP_001229392.1
• RefSeq Size: 6521
• RefSeq ORF: 789
• Locus ID: 114907
• Gene Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and contains an F-box domain. This protein is highly expressed during muscle atrophy, whereas mice deficient in this gene were found to be resistant to atrophy. This protein is thus a potential drug target for the treatment of muscle atrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
  Transcript Variant: This variant (3) lacks two in-frame exons in the coding region, compared to variant 1. This encodes a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.