Guanylate kinase (GUK1) (NM_001242839) Human Untagged Clone

CAT#: SC330026

GUK1 (untagged) - Homo sapiens guanylate kinase 1 (GUK1), transcript variant 4


  "NM_001242839" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GUK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GUK1
Synonyms GMK
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001242839, the custom clone sequence may differ by one or more nucleotides


ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACCCTGCTGAAGAGGC
TGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACCACGAGGAACCCGAGGCCCGGCGA
GGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAGGTGATGCAGCGTGACATAGCAGCCGGCGACTTC
ATCGAGCATGCCGAGTTCTCGGGGAACCTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCA
TGAACCGCATCTGTGTGCTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCC
CATCTACATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACTGAA
ACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGCAAGGAGCCCGGCC
TGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAGCTGAAGGAGGCGCTCTCTGA
GGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001242839
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242839.1, NP_001229768.1
RefSeq Size 930 bp
RefSeq ORF 594 bp
Locus ID 2987
Cytogenetics 1q42.13
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
Gene Summary 'The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]'
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence and contains an alternate coding exon in the 3' end compared to variant 5, that causes a frameshift. The resulting isoform (b) is shorter at the N-terminus and has a shorter and distinct C-terminus compared to isoform c. Variants 2, 3, and 4 all encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.