PRPSAP2 (NM_001243936) Human Untagged Clone

CAT#: SC330194

PRPSAP2 (untagged) - Homo sapiens phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), transcript variant 2


  "NM_001243936" in other vectors (2)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRPSAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRPSAP2
Synonyms PAP41
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243936, the custom clone sequence may differ by one or more nucleotides


ATGTTTTGTGTGACGCCACCTGAATTAGAAACCAAGATGAACATAACCAAAGGTGGTCTGGTGTTGTTTT
CAGCAAACTCGAATTCATCATGTATGGAGCTATCAAAGAAAATTGCAGAGGACGTGAACACCACCATCAT
GGAGCTCCTGATCATGGTGTATGCATGTAAGACCTCTTGTGCCAAGAGCATCATTGGCGTGATACCCTAC
TTTCCTTACAGCAAGCAGTGCAAGATGAGAAAAAGAGGCTCCATTGTCTCTAAATTGCTGGCTTCCATGA
TGTGCAAAGCTGGTCTAACTCATCTTATTACTATGGATTTACACCAGAAGGAAATTCAGGGCTTCTTCAA
TATTCCTGTTGACAATTTAAGAGCATCTCCCTTCTTATTACAGTATATTCAAGAAGAGATCCCAGATTAC
AGGAATGCAGTAATCGTGGCCAAGTCTCCAGCCTCGGCGAAGAGGGCACAGTCTTTTGCTGAGCGCCTGC
GCCTGGGAATTGCAGTGATTCATGGAGAGGCGCAGGATGCCGAGTCGGACTTGGTGGATGGACGGCATTC
CCCACCCATGGTCAGAAGTGTGGCTGCCATCCACCCCAGCCTGGAGATCCCCATGCTGATTCCTAAAGAA
AAGCCCCCAATCACGGTTGTGGGTGATGTTGGAGGAAGGATTGCCATCATCGTGGATGACATCATTGATG
ATGTTGACAGCTTTCTTGCTGCAGCAGAGACCCTGAAGGAAAGAGGTGCATATAAGATCTTTGTGATGGC
AACTCATGGCTTGTTGTCTTCTGACGCCCCCCGGCGGATTGAAGAGTCTGCCATTGATGAGGTGGTGGTC
ACCAATACAATTCCACATGAAGTCCAGAAGCTCCAGTGCCCCAAGATTAAAACTGTGGATATCAGCATGA
TCCTTTCAGAGGCGATCCGTCGGATCCACAATGGGGAGTCCATGTCCTACCTTTTCAGAAACATAGGCTT
AGATGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001243936
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243936.1, NP_001230865.1
RefSeq Size 1838 bp
RefSeq ORF 990 bp
Locus ID 5636
Cytogenetics 17p11.2
Protein Families Druggable Genome
Gene Summary 'This gene encodes a protein that associates with the enzyme phosphoribosylpyrophosphate synthetase (PRS). PRS catalyzes the formation of phosphoribosylpyrophosphate which is a substrate for synthesis of purine and pyrimidine nucleotides, histidine, tryptophan and NAD. PRS exists as a complex with two catalytic subunits and two associated subunits. This gene encodes a non-catalytic associated subunit of PRS. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]'
Transcript Variant: This variant (2) differs in the 5' UTR, lacks two in-frame exons in the coding region and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.