TFEC (NM_001244583) Human Untagged Clone

CAT#: SC330212

TFEC (untagged) - Homo sapiens transcription factor EC (TFEC), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TFEC
• Synonyms: bHLHe34; hTFEC-L; TCFEC; TFE-C; TFEC-L; TFECL
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244583, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGAAGGAGAAAGAGAAAACCATTGCTATTGTGAAGGTTATAGACACTTCAAAGTTAAAACTGTTAT
  CTGGAAGTATTTTGGATGTGTATAGCGGTGAACAAGGAATTTCACCAATTAACATGGGGCTTACAAGTGC
  TTCTTGTCCAAGTAGTCTACCAATGAAAAGAGAAATTACAGAAACTGACACTAGAGCTTTAGCAAAAGAG
  AGACAAAAAAAGGACAACCACAACCTCATTGAAAGAAGAAGAAGGTATAATATTAATTACCGAATCAAGG
  AGCTTGGCACTCTTATTCCAAAGTCTAATGATCCTGATATGCGCTGGAACAAAGGAACCATTCTAAAAGC
  ATCAGTGGAGTACATCAAGTGGCTACAAAAAGAACAACAGAGAGCCCGAGAATTGGAACACAGACAGAAG
  AAATTAGAGCAGGCTAACAGGCGACTTCTACTTCGGATTCAGGAACTAGAAATTCAGGCTCGTACTCATG
  GTCTGCCAACCCTGGCTTCACTTGGCACGGTTGATTTAGGTGCTCATGTCACCAAACAGCAGAGCCATCC
  TGAGCAGAATTCAGTAGACTATTGCCAACAACTGACTGTGTCTCAGGGGCCAAGCCCTGAGCTCTGTGAT
  CAAGCTATAGCCTTTTCTGATCCTTTGTCATACTTCACAGATTTATCATTTAGTGCTGCATTGAAAGAGG
  AACAAAGATTGGATGGCATGCTATTGGATGACACAATCTCTCCATTTGGAACAGATCCTCTGCTATCTGC
  CACTTCCCCTGCAGTTTCCAAAGAAAGCAGTAGGAGAAGTAGCTTTAGCTCAGATGATGGTGATGAATTA
  TAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244583
• ORF Size: 843 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001244583.1, NP_001231512.1
• RefSeq Size: 6309
• RefSeq ORF: 843
• Locus ID: 22797
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a member of the micropthalmia (MiT) family of basic helix-loop-helix leucine zipper transcription factors. MiT transcription factors regulate the expression of target genes by binding to E-box recognition sequences as homo- or heterodimers, and play roles in multiple cellular processes including survival, growth and differentiation. The encoded protein is a transcriptional activator of the nonmuscle myosin II heavy chain-A gene, and may also co-regulate target genes in osteoclasts as a heterodimer with micropthalmia-associated transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.