AP4S1 (NM_001254727) Human Untagged Clone

CAT#: SC330319

AP4S1 (untagged) - Homo sapiens adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 4


  "NM_001254727" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AP4S1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AP4S1
Synonyms AP47B; CLA20; CLAPS4; CPSQ6; SPG52
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001254727, the custom clone sequence may differ by one or more nucleotides


ATGATAAAATTTTTCCTCATGGTGAATAAACAAGGGCAGACTCGACTTTCTAAGTACTATGAACATGTGG
ATATTAATAAGCGTACACTTCTGGAAACAGAAGTCATAAAGAGCTGTCTCTCTCGATCCAATGAACAATG
CTCTTTCATTGAATATAAGGATTTTAAGCTGATATATCGGCAGTATGCAGCTCTCTTCATTGTGGTTGGA
GTTAATGACACTGAGAACGAGATGGCTATTTATGAATTCATTCATAACTTTGTGGAAGTTTTAGATGAGT
ATTTCAGCCGAGTGAGTGAATTAGATGTATCCTTTTTCAATACTGTTTTCCACAGTACTTGGCAAATGCA
CTCTGGTCCTTATCAGACAAGGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGAGGTGCGATCATGGCTCA
CTACACCCTGGATCTCCTGGGCTCAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001254727
ORF Size 450 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001254727.1, NP_001241656.1
RefSeq Size 1926
RefSeq ORF 450
Locus ID 11154
Protein Pathways Lysosome
Gene Summary This gene encodes a member of the adaptor complexes small subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is the small subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Mutations in this gene are associated with spastic quadriplegic cerebral palsy-6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (4) contains an alternate internal exon, which results in a frameshift, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.