AP4S1 (NM_001254727) Human Untagged Clone
CAT#: SC330319
AP4S1 (untagged) - Homo sapiens adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 4
"NM_001254727" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AP4S1 |
Synonyms | AP47B; CLA20; CLAPS4; CPSQ6; SPG52 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001254727, the custom clone sequence may differ by one or more nucleotides
ATGATAAAATTTTTCCTCATGGTGAATAAACAAGGGCAGACTCGACTTTCTAAGTACTATGAACATGTGG ATATTAATAAGCGTACACTTCTGGAAACAGAAGTCATAAAGAGCTGTCTCTCTCGATCCAATGAACAATG CTCTTTCATTGAATATAAGGATTTTAAGCTGATATATCGGCAGTATGCAGCTCTCTTCATTGTGGTTGGA GTTAATGACACTGAGAACGAGATGGCTATTTATGAATTCATTCATAACTTTGTGGAAGTTTTAGATGAGT ATTTCAGCCGAGTGAGTGAATTAGATGTATCCTTTTTCAATACTGTTTTCCACAGTACTTGGCAAATGCA CTCTGGTCCTTATCAGACAAGGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGAGGTGCGATCATGGCTCA CTACACCCTGGATCTCCTGGGCTCAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001254727 |
ORF Size | 450 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001254727.1, NP_001241656.1 |
RefSeq Size | 1926 |
RefSeq ORF | 450 |
Locus ID | 11154 |
Protein Pathways | Lysosome |
Gene Summary | This gene encodes a member of the adaptor complexes small subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is the small subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Mutations in this gene are associated with spastic quadriplegic cerebral palsy-6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (4) contains an alternate internal exon, which results in a frameshift, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231852 | AP4S1 (Myc-DDK tagged) - Homo sapiens adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 4 |
USD 420.00 |
|
RG231852 | AP4S1 (GFP-tagged) - Homo sapiens adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review