AP4S1 (NM_001254728) Human Untagged Clone

CAT#: SC330320

AP4S1 (untagged) - Homo sapiens adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AP4S1
• Synonyms: AP47B; CLA20; CLAPS4; CPSQ6; SPG52
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001254728, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATAAAATTTTTCCTCATGGTGAATAAACAAGGGCAGACTCGACTTTCTAAGTACTATGAACATGTGG
  ATATTAATAAGCGTACACTTCTGGAAACAGAAGTCATAAAGAGCTGTCTCTCTCGATCCAATGAACAATG
  CTCTTTCATTGAATATAAGGATTTTAAGCTGATATATCGGCAGTATGCAGCTCTCTTCATTGTGGTTGGA
  GTTAATGACACTGAGAACGAGATGGCTATTTATGAATTCATTCATAACTTTGTGGAAGTTTTAGATGAGT
  ATTTCAGCCGAGTGAGTGAATTAGATATAATGTTTAATTTGGATAAAGTACACATCATTTTGGATGAGAT
  GGTGTTAAATGGCTGCATTGTGGAAACTAACAGGGCAAGAATTCTTGCCCCTCTACTAATTCTTGATAAG
  ATGTCAGAAAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001254728
• ORF Size: 435 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001254728.1, NP_001241657.1
• RefSeq Size: 4617
• RefSeq ORF: 435
• Locus ID: 11154
• Protein Pathways: Lysosome
• Gene Summary: This gene encodes a member of the adaptor complexes small subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is the small subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Mutations in this gene are associated with spastic quadriplegic cerebral palsy-6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (5) differs in the 5' UTR, uses an alternate splice site in the 3' coding region and has an alternate terminal exon, compared to variant 1. Variants 2, 5 and 6 encode the same isoform (2), which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.