PTGES2 (NM_001256335) Human Untagged Clone

CAT#: SC330397

PTGES2 (untagged) - Homo sapiens prostaglandin E synthase 2 (PTGES2), transcript variant 5


  "NM_001256335" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTGES2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTGES2
Synonyms C9orf15; GBF-1; GBF1; mPGES-2; PGES2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256335, the custom clone sequence may differ by one or more nucleotides


ATGAAGGCTGTGAACGAGCAGGGCAAGGAGGTGACCGAGTTCGGCAATAAGTACTGGCTCATGCTCAACG
AGAAGGAGGCCCAGCAAGTGTATGGTGGGAAGGAGGCCAGGACGGAGGAGATGAAGTGGCGGCAGTGGGC
GGACGACTGGCTGGTGCACCTGATCTCCCCCAATGTGTACCGCACGCCCACCGAGGCTCTGGCGTCCTTT
GACTACATTGTCCGCGAGGGCAAGTTCGGAGCCGTGGAGGGTGCCGTGGCCAAGTACATGGGTGCAGCGG
CCATGTACCTCATCAGCAAGCGACTCAAGAGCAGGCACCGCCTCCAGGACAACGTGCGCGAGGACCTCTA
TGAGGCTGCTGACAAGTGGGTGGCTGCTGTGGGCAAGGACCGGCCCTTCATGGGGGGCCAGAAGCCGAAT
CTCGCTGATTTGGCGGTGTATGGCGTGCTGCGTGTGATGGAGGGGCTGGATGCGTTCGATGACCTGATGC
AGCACACGCACATCCAGCCCTGGTACCTGCGGGTGGAGAGGGCCATCACCGAGGCCTCCCCAGCGCACTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001256335
ORF Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256335.1, NP_001243264.1
RefSeq Size 1369
RefSeq ORF 561
Locus ID 80142
Protein Pathways Arachidonic acid metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene is a membrane-associated prostaglandin E synthase, which catalyzes the conversion of prostaglandin H2 to prostaglandin E2. This protein also has been shown to activate the transcription regulated by a gamma-interferon-activated transcription element (GATE). Multiple transcript variants have been found for this gene. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Both variants 2 and 5 encode isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.