CABLES1 (NM_001256438) Human Untagged Clone

CAT#: SC330428

CABLES1 (untagged) - Homo sapiens Cdk5 and Abl enzyme substrate 1 (CABLES1), transcript variant 4


  "NM_001256438" in other vectors (2)

Reconstitution Protocol

USD 320.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CABLES1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CABLES1
Synonyms CABL1; CABLES; HsT2563; IK3-1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256438, the custom clone sequence may differ by one or more nucleotides


ATGCGGCAACACGATACCAGGAATGGCAGAATAGTCCTTATCAGTGGCAGAAGATCCTTCTGTAGTATAT
TTTCAGTGCTGCCGTATCGCGACAGTACCCAAGTCGGGGACTTGAAGTTGGACGGAGGAAGACAATCAAC
TGGTGCAGTGAGTTTGAAAGAGATCATTGGTCTGGAAGGTGTGGAGCTGGGTGCTGATGGGAAGACTGTT
TCCTATACCCAATTTCTGTTACCCACAAATGCCTTTGGAGCCCGGAGAAATACCATAGACTCCACCTCCT
CTTTCTCCCAGTTCCGTAACCTGAGCCACCGCAGCCTCTCCATAGGCCGGGCAAGCGGCACCCAGGGGAG
CCTCGACACAGGTAGTGACCTGGGAGACTTTATGGACTATGACCCAAATCTCTTGGATGACCCCCAGTGG
CCTTGTGGCAAACACAAACGCGTTCTGATCTTCCCTTCCTACATGACAACAGTGATTGACTACGTGAAGC
CCTCGGATCTCAAGAAGGACATGAACGAGACCTTCAAGGAGAAGTTTCCTCACATTAAGCTGACACTCAG
CAAAATTAGGAGTCTGAAACGAGAGATGCGGAAGCTTGCGCAGGAGGACTGTGGCCTTGAGGAGCCCACG
GTGGCCATGGCCTTCGTCTACTTTGAAAAGCTCGCCCTCAAGGGGAAACTCAACAAACAGAACCGGAAGC
TGTGTGCTGGGGCATGTGTGCTGTTAGCAGCCAAAATTGGAAGTGACCTCAAAAAACACGAAGTCAAGCA
TTTAATTGACAAACTGGAAGAGAAGTTCCGGCTGAACAGGCGAGAACTGATTGCCTTTGAATTCCCGGTG
TTAGTGGCCTTGGAATTCGCCCTCCACTTGCCCGAGCACGAAGTCATGCCCCACTACAGACGGCTGGTCC
AGAGTTCCTAG


Restriction Sites SgfI-RsrII     
ACCN NM_001256438
ORF Size 921 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256438.1, NP_001243367.1
RefSeq Size 4267
RefSeq ORF 921
Locus ID 91768
Gene Summary This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and use an alternate start codon compared to variant 1. The resulting protein (isoform 3) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.