LIF (NM_001257135) Human Untagged Clone
CAT#: SC330571
LIF (untagged) - Homo sapiens leukemia inhibitory factor (LIF), transcript variant 2
"NM_001257135" in other vectors (2)
Product Images
Other products for "LIF"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | LIF |
| Synonyms | CDF; DIA; HILDA; MLPLI |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001257135, the custom clone sequence may differ by one or more nucleotides
ATGAAGGTCTTGGCGGCAGTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGGC CCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTACC GCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAGTGC CCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001257135 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001257135.1, NP_001244064.1 |
| RefSeq Size | 3808 bp |
| RefSeq ORF | 267 bp |
| Locus ID | 3976 |
| Cytogenetics | 22q12.2 |
| Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
| Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
| Gene Summary | 'The protein encoded by this gene is a pleiotropic cytokine with roles in several different systems. It is involved in the induction of hematopoietic differentiation in normal and myeloid leukemia cells, induction of neuronal cell differentiation, regulator of mesenchymal to epithelial conversion during kidney development, and may also have a role in immune tolerance at the maternal-fetal interface. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]' Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China