GNAL (NM_001261443) Human Untagged Clone

CAT#: SC330711

GNAL (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNAL
• Synonyms: DYT25
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001261443, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGTGTTTGGGCGGCAACAGCAAGACGACGGAAGACCAGGGCGTCGATGAAAAAGAACGACGCGAGG
  CCAACAAAAAGATCGAGAAGCAGTTGCAGAAAGAGCGCCTGGCTTACAAGGCTACCCACCGCCTGCTGCT
  CCTGGGGGCTGGTGAGTCTGGGAAAAGCACTATCGTCAAACAGATGAGGATCCTGCACGTCAATGGGTTT
  AATCCCGAGGAAAAGAAACAGAAAATTCTGGACATCCGGAAAAATGTTAAAGATGCTATCGTGACAATTG
  TTTCAGCAATGAGTACTATAATACCTCCAGTTCCGCTGGCCAACCCTGAAAACCAATTTCGATCAGACTA
  CATCAAGAGCATAGCCCCTATCACTGACTTTGAATATTCCCAGGAATTCTTTGACCATGTGAAAAAACTT
  TGGGACGATGAAGGCGTGAAGGCATGCTTTGAGAGATCCAACGAATACCAGCTGATTGACTGTGCACAAT
  ACTTCCTGGAAAGAATCGACAGCGTCAGCTTGGTTGACTACACACCCACAGACCAGGACCTCCTCAGATG
  CAGAGTTCTGACATCTGGGATTTTTGAGACACGATTCCAAGTGGACAAAGTAAACTTCCACATGTTTGAT
  GTTGGTGGCCAGAGGGATGAGAGGAGAAAATGGATCCAGTGCTTTAACGATGTCACAGCTATCATTTACG
  TCGCAGCCTGCAGTAGCTACAACATGGTGATTCGAGAAGATAACAACACCAACAGGCTGAGAGAGTCCCT
  GGATCTTTTTGAAAGCATCTGGAACAACAGGTGGTTACGGACCATTTCTATCATCTTGTTCTTGAACAAA
  CAAGATATGCTGGCAGAAAAAGTCTTGGCAGGGAAATCAAAAATTGAAGACTATTTCCCAGAATATGCAA
  ATTATACTGTTCCTGAAGACGCAACACCAGATGCAGGAGAAGATCCCAAAGTTACAAGAGCCAAGTTCTT
  TATCCGGGACCTGTTTTTGAGGATCAGCACGGCCACCGGTGACGGCAAACATTACTGCTACCCGCACTTC
  ACCTGCGCCGTGGACACAGAGAACATCCGCAGGGTGTTCAACGACTGCCGCGACATCATCCAGCGGATGC
  ACCTCAAGCAGTATGAGCTCTTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001261443
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001261443.1, NP_001248372.1
• RefSeq Size: 5850 bp
• RefSeq ORF: 1146 bp
• Locus ID: 2774
• Cytogenetics: 18p11.21
• Protein Families: Druggable Genome
• Protein Pathways: Calcium signaling pathway, Olfactory transduction
• Gene Summary: 'This gene encodes a stimulatory G protein alpha subunit which mediates odorant signaling in the olfactory epithelium. This protein couples dopamine type 1 receptors and adenosine A2A receptors and is widely expressed in the central nervous system. Mutations in this gene have been associated with dystonia 25 and this gene is located in a susceptibility region for bipolar disorder and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]'
  Transcript Variant: This variant (4) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (2), which is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.