GNAL (NM_001261443) Human Untagged Clone
CAT#: SC330711
GNAL (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 4
"NM_001261443" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GNAL |
Synonyms | DYT25 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001261443, the custom clone sequence may differ by one or more nucleotides
ATGGGGTGTTTGGGCGGCAACAGCAAGACGACGGAAGACCAGGGCGTCGATGAAAAAGAACGACGCGAGG CCAACAAAAAGATCGAGAAGCAGTTGCAGAAAGAGCGCCTGGCTTACAAGGCTACCCACCGCCTGCTGCT CCTGGGGGCTGGTGAGTCTGGGAAAAGCACTATCGTCAAACAGATGAGGATCCTGCACGTCAATGGGTTT AATCCCGAGGAAAAGAAACAGAAAATTCTGGACATCCGGAAAAATGTTAAAGATGCTATCGTGACAATTG TTTCAGCAATGAGTACTATAATACCTCCAGTTCCGCTGGCCAACCCTGAAAACCAATTTCGATCAGACTA CATCAAGAGCATAGCCCCTATCACTGACTTTGAATATTCCCAGGAATTCTTTGACCATGTGAAAAAACTT TGGGACGATGAAGGCGTGAAGGCATGCTTTGAGAGATCCAACGAATACCAGCTGATTGACTGTGCACAAT ACTTCCTGGAAAGAATCGACAGCGTCAGCTTGGTTGACTACACACCCACAGACCAGGACCTCCTCAGATG CAGAGTTCTGACATCTGGGATTTTTGAGACACGATTCCAAGTGGACAAAGTAAACTTCCACATGTTTGAT GTTGGTGGCCAGAGGGATGAGAGGAGAAAATGGATCCAGTGCTTTAACGATGTCACAGCTATCATTTACG TCGCAGCCTGCAGTAGCTACAACATGGTGATTCGAGAAGATAACAACACCAACAGGCTGAGAGAGTCCCT GGATCTTTTTGAAAGCATCTGGAACAACAGGTGGTTACGGACCATTTCTATCATCTTGTTCTTGAACAAA CAAGATATGCTGGCAGAAAAAGTCTTGGCAGGGAAATCAAAAATTGAAGACTATTTCCCAGAATATGCAA ATTATACTGTTCCTGAAGACGCAACACCAGATGCAGGAGAAGATCCCAAAGTTACAAGAGCCAAGTTCTT TATCCGGGACCTGTTTTTGAGGATCAGCACGGCCACCGGTGACGGCAAACATTACTGCTACCCGCACTTC ACCTGCGCCGTGGACACAGAGAACATCCGCAGGGTGTTCAACGACTGCCGCGACATCATCCAGCGGATGC ACCTCAAGCAGTATGAGCTCTTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001261443 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001261443.1, NP_001248372.1 |
RefSeq Size | 5850 bp |
RefSeq ORF | 1146 bp |
Locus ID | 2774 |
Cytogenetics | 18p11.21 |
Protein Families | Druggable Genome |
Protein Pathways | Calcium signaling pathway, Olfactory transduction |
Gene Summary | 'This gene encodes a stimulatory G protein alpha subunit which mediates odorant signaling in the olfactory epithelium. This protein couples dopamine type 1 receptors and adenosine A2A receptors and is widely expressed in the central nervous system. Mutations in this gene have been associated with dystonia 25 and this gene is located in a susceptibility region for bipolar disorder and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]' Transcript Variant: This variant (4) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (2), which is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232621 | GNAL (Myc-DDK tagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 4 |
USD 420.00 |
|
RG232621 | GNAL (GFP-tagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review