SLIRP (NM_001267863) Human Untagged Clone

CAT#: SC330797

SLIRP (untagged) - Homo sapiens SRA stem-loop interacting RNA binding protein (SLIRP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLIRP
• Synonyms: C14orf156; DC50; PD04872
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267863, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCCTCAGCAGCGAGAGGTGCTGCGGCGCTGCGTAGAAGTATCAATCAGCCGGTTGCTTTTGTGA
  GAAGAATTCCTTGGACTGCGGCGTCGAGTCAGCTGAAAGAACACTTTGCACAGTTCGGCCATGTCAGAAG
  GTGCATTTTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCAGAA
  GAAGGACTTCGGAATGCACTACAACAGGAAAATCATATTATAGATGGAGTAAAGGTTCACACTAGAAGGC
  CAAAACTTCCGCAAACATCTGATGATGAAAAGAAAGATTTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267863
• ORF Size: 324 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001267863.1, NP_001254792.1
• RefSeq Size: 414
• RefSeq ORF: 324
• Locus ID: 81892
• Gene Summary: Steroid receptor RNA activator (SRA, or SRA1; MIM 603819) is a complex RNA molecule containing multiple stable stem-loop structures that functions in coactivation of nuclear receptors. SLIRP interacts with stem-loop structure-7 of SRA (STR7) and modulates nuclear receptor transactivation (Hatchell et al., 2006 [PubMed 16762838]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.