SLIRP (NM_001267864) Human Untagged Clone

CAT#: SC330798

SLIRP (untagged) - Homo sapiens SRA stem-loop interacting RNA binding protein (SLIRP), transcript variant 3


  "NM_001267864" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLIRP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLIRP
Synonyms C14orf156; DC50; PD04872
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001267864, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCCTCAGCAGCGAGAGGTGCTGCGGCGCTGCGTAGAAGTATCAATCAGCCGGTTGCTTTTGTGA
GAAGAATTCCTTGGACTGCGGCGTCGAGTCAGCTGAAAGAACACTTTGCACAGTTCGGCCATGTCAGAAG
GTGCATTTTACCTTTTGACAAGGAGACTGGCTTTCACAGAGGTTTGGGTTGGGTTCAGTTTTCTTCAGAA
GAAGGACTTCGGAATGCACTACAACAGGAAAATCATATTATAGATGGAGTAAAGTGCTTATTTTTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001267864
ORF Size 279 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001267864.1, NP_001254793.1
RefSeq Size 436
RefSeq ORF 279
Locus ID 81892
Gene Summary Steroid receptor RNA activator (SRA, or SRA1; MIM 603819) is a complex RNA molecule containing multiple stable stem-loop structures that functions in coactivation of nuclear receptors. SLIRP interacts with stem-loop structure-7 of SRA (STR7) and modulates nuclear receptor transactivation (Hatchell et al., 2006 [PubMed 16762838]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.