LMO1 (NM_001270428) Human Untagged Clone

CAT#: SC330832

LMO1 (untagged) - Homo sapiens LIM domain only 1 (rhombotin 1) (LMO1), transcript variant 2


  "NM_001270428" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LMO1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LMO1
Synonyms RBTN1; RHOM1; TTG1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270428, the custom clone sequence may differ by one or more nucleotides


ATGGTGTTGGACCAGGAGGACGGCGTGCCGATGCTCTCCGTCCAGCCCAAAGGGAAGCAGAAGGGCTGTG
CGGGCTGTAACCGCAAGATCAAGGACCGCTATCTGCTGAAGGCATTGGACAAGTACTGGCACGAAGACTG
CCTCAAGTGTGCCTGCTGTGACTGCCGCCTGGGCGAGGTGGGCTCCACCCTCTACACCAAGGCCAACCTC
ATCCTGTGCCGACGCGACTACCTGAGGCTCTTTGGCACCACAGGGAACTGTGCTGCTTGCAGCAAGCTGA
TCCCAGCCTTCGAGATGGTGATGCGGGCCCGGGACAACGTGTATCACCTCGACTGCTTCGCCTGCCAGCT
CTGCAACCAGAGATTTTGTGTGGGAGACAAATTCTTCCTGAAGAACAACATGATCTTGTGTCAGATGGAC
TATGAGGAAGGGCAGCTCAATGGCACCTTTGAATCCCAAGTTCAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001270428
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270428.1, NP_001257357.1
RefSeq Size 983 bp
RefSeq ORF 468 bp
Locus ID 4004
Cytogenetics 11p15.4
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'This locus encodes a transcriptional regulator that contains two cysteine-rich LIM domains but lacks a DNA-binding domain. LIM domains may play a role in protein interactions; thus the encoded protein may regulate transcription by competitively binding to specific DNA-binding transcription factors. Alterations at this locus have been associated with acute lymphoblastic T-cell leukemia. Chromosomal rearrangements have been observed between this locus and at least two loci, the delta subunit of the T-cell antigen receptor gene and the LIM domain binding 1 gene. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2012]'
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.