PPP2R5D (NM_001270476) Human Untagged Clone

CAT#: SC330847

PPP2R5D (untagged) - Homo sapiens protein phosphatase 2, regulatory subunit B', delta (PPP2R5D), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP2R5D
• Synonyms: B56D; B56delta; MRD35
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270476, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGGAGTACATCACCCATAGCCGTGATGTTGTCACTGAGGCCATTTACCCTGAGGCTGTCACCATGT
  TTTCAGTGAACCTCTTCCGGACGCTGCCACCTTCATCGAATCCCACAGGGGCTGAGTTTGACCCAGAGGA
  AGATGAGCCCACCCTGGAAGCTGCTTGGCCACATCTCCAGCTCGTGTATGAGTTCTTCTTACGTTTCCTT
  GAGTCTCCTGATTTCCAGCCAAACATAGCCAAGAAGTACATCGACCAGAAGTTTGTACTTGCTCTCCTAG
  ACCTATTTGACAGTGAGGATCCTCGAGAGCGGGACTTCCTCAAGACCATTTTGCATCGCATCTATGGCAA
  GTTTTTGGGGCTCCGGGCTTATATCCGTAGGCAGATCAACCACATCTTCTACAGGTTCATCTACGAGACG
  GAGCATCACAACGGGATTGCTGAGCTCCTGGAGATCCTGGGCAGCATCATCAATGGCTTTGCCCTGCCCC
  TTAAAGAAGAGCACAAGATGTTCCTCATCCGTGTCCTACTTCCCCTTCACAAGGTCAAGTCCCTGAGTGT
  CTACCACCCTCAGCTGGCATACTGTGTGGTACAATTCCTGGAGAAGGAGAGCAGTCTGACTGAGCCGGTA
  ATTGTGGGACTTCTCAAGTTTTGGCCCAAGACCCACAGCCCCAAGGAGGTGATGTTCTTGAATGAGCTGG
  AGGAGATTCTGGACGTCATTGAACCTTCTGAGTTCAGCAAAGTGATGGAACCCCTCTTCCGCCAGCTGGC
  CAAGTGTGTCTCTAGCCCCCATTTCCAGGTGGCAGAGCGTGCTCTCTATTACTGGAACAATGAGTACATC
  ATGAGCCTGATAAGTGACAATGCTGCCCGAGTCCTCCCCATCATGTTCCCTGCACTCTACAGGAACTCCA
  AGAGCCACTGGAACAAGACAATCCATGGACTGATCTATAATGCCCTGAAGTTGTTTATGGAAATGAATCA
  GAAGCTGTTTGATGACTGCACACAACAATACAAGGCAGAGAAGCAGAAGGGCCGGTTCCGAATGAAGGAA
  AGGGAAGAGATGTGGCAAAAAATCGAGGAGCTGGCCCGGCTTAATCCCCAGTATCCCATGTTCCGAGCCC
  CTCCACCACTGCCCCCTGTGTACTCGATGGAGACAGAGACCCCCACAGCTGAGGACATCCAGCTTCTGAA
  GAGGACTGTGGAGACTGAGGCTGTTCAGATGCTAAAAGACATCAAGAAGGAGAAAGTGCTGCTGCGGAGG
  AAGTCGGAGCTGCCCCAGGACGTGTACACCATCAAGGCACTGGAGGCGCACAAGCGGGCGGAAGAGTTCC
  TAACTGCCAGCCAGGAGGCTCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270476
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001270476.1, NP_001257405.1
• RefSeq Size: 3082 bp
• RefSeq ORF: 1356 bp
• Locus ID: 5528
• Cytogenetics: 6p21.1
• Protein Families: Phosphatase
• Protein Pathways: Oocyte meiosis, Wnt signaling pathway
• Gene Summary: 'The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a delta isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (4) uses an alternate splice junction at the 5' end of an exon compared to variant 1, resulting in a transcript that is translated from a downstream AUG. The resulting isoform (4) is shorter at the N-terminus compared to isoform 1.