Josephin 2 (JOSD2) (NM_001270641) Human Untagged Clone

CAT#: SC330864

JOSD2 (untagged) - Homo sapiens Josephin domain containing 2 (JOSD2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: JOSD2
• Synonyms: SBBI54
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270641, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCCAGGCCCCGGGAGCACAGCCGAGCCCACCCACCGTGTACCACGAACGGCAGCGCCTGGAGCTGT
  GTGCTGTCCACGCCCTCAACAACGTTCTGCAGCAGCAGCTCTTTAGCCAGGAGGCTGCCGATGAGATCTG
  CAAGAGGCCCCTGTCCCAGCTGGCCCTGCCCCAGGTACTGGGGCTGATCCTGAACCTGCCCTCGCCCGTG
  TCGCTGGGGCTGCTGTCACTGCCGCTGCGCCGGCGGCACTGGGTGGCCCTGCGCCAGGTGGACGGTGTCT
  ACTACAACCTGGACTCCAAGCTGCGGGCGCCCGAGGCCCTGGGGGATGAGGACGGAGTCAGGGCCTTCCT
  GGCGGCTGCGCTGGCCCAGGGCCTGTGCGAGGTGCTGCTGGTAGTGACCAAGGAGGTGGAGGAGAAGGGC
  AGCTGGCTGCGGACAGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270641
• ORF Size: 441 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270641.1, NP_001257570.1
• RefSeq Size: 891
• RefSeq ORF: 441
• Locus ID: 126119
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.