Nurim (NRM) (NM_001270708) Human Untagged Clone

CAT#: SC330868

NRM (untagged) - Homo sapiens nurim (nuclear envelope membrane protein) (NRM), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NRM
• Synonyms: NRM29
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270708, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCCTGCACTGCTCCTGATCCCTGCTGCCCTCGCCTCTTTCATCCTGGCCTTTGGCACCGGAGTGG
  AGTTCGTGCGCTTTACCTCCCTTCGGCCACTTCTTGGAGGGATCCCGGAGTCTGGTGGTCCGGATGCCCG
  CCAGGGATGGCTGGCTGCCCTGCAGGACCGCAGCATCCTTGCCCCCCTGGCATGGGATCTGGGGCTCCTG
  CTTCTATTTGTTGGGCAGCACAGCCTCATGGCAGCTGAAAGAGTGAAGGCATGGACATCCCGGTACTTTG
  GGGTCCTTCAGAGGTCACTGTATGTGGCCTGCACTGCCCTGGCCTTGCAGGTATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270708
• ORF Size: 336 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270708.1, NP_001257637.1
• RefSeq Size: 1415
• RefSeq ORF: 336
• Locus ID: 11270
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (3) differs in the 5' and 3' UTR and uses an alternate in-frame splice site in the coding region compared to variant 1. It terminates translation at an alternate stop codon resulting in an isoform (3) that is shorter than isoform 1.