Nurim (NRM) (NM_001270709) Human Untagged Clone

CAT#: SC330869

NRM (untagged) - Homo sapiens nurim (nuclear envelope membrane protein) (NRM), transcript variant 4


  "NM_001270709" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NRM
Synonyms NRM29
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270709, the custom clone sequence may differ by one or more nucleotides


ATGGCCCCTGCACTGCTCCTGATCCCTGCTGCCCTCGCCTCTTTCATCCTGGCCTTTGGCACCGGAGTGG
AGTTCGTGCGCTTTACCTCCCTTCGGCCACTTCTTGGAGGGATCCCGGAGTCTGGTGGTCCGGATGCCCG
CCAGGGATGGCTGGCTGCCCTGCAGGACCGCAGCATCCTTGCCCCCCTGGCATGGGATCTGGGGCTCCTG
CTTCTATTTGTTGGGCAGCACAGCCTCATGGCAGCTGAAAGAGTGAAGGCATGGACATCCCGGTACTTTG
GGGTCCTTCAGAGGTCACTGTATGTGGCCTGCACTGCCCTGGCCTTGCAGGTATACTACCATGTGCTGGG
GCTGGGCGAGCCTCTGGCCCTGAAGTCTCCCCGGGCTCTCAGACTCTTCTCCCACCTGCGCCACCCAGTG
TGTGTGGAGCTGCTGACAGTGCTGTGGGTGGTGCCTACCCTGGGCACGGACCGTCTCCTCCTTGCTTTCC
TCCTTACCCTCTACCTGGGCCTGGCTCACGGGCTTGATCAGCAAGACCTCCGCTACCTCCGGGCCCAGCT
ACAAAGAAAACTCCACCTGCTCTCTCGGCCCCAGGATGGGGAGGCAGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001270709
ORF Size 612 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270709.1, NP_001257638.1
RefSeq Size 1393
RefSeq ORF 612
Locus ID 11270
Protein Families Transmembrane
Gene Summary The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 4 which is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.