Nurim (NRM) (NM_001270710) Human Untagged Clone
CAT#: SC330870
NRM (untagged) - Homo sapiens nurim (nuclear envelope membrane protein) (NRM), transcript variant 5
"NM_001270710" in other vectors (2)
Product Images
Other products for "NRM"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NRM |
Synonyms | NRM29 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270710, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCTGCACTGCTCCTGATCCCTGCTGCCCTCGCCTCTTTCATCCTGGCCTTTGGCACCGGAGTGG AGTTCGTGCGCTTTACCTCCCTTCGGCCACTTCTTGGAGGGATCCCGGAGTCTGGTGGTCCGGGTATACT ACCATGTGCTGGGGCTGGGCGAGCCTCTGGCCCTGAAGTCTCCCCGGGCTCTCAGACTCTTCTCCCACCT GCGCCACCCAGTGTGTGTGGAGCTGCTGACAGTGCTGTGGGTGGTGCCTACCCTGGGCACGGACCGTCTC CTCCTTGCTTTCCTCCTTACCCTCTACCTGGGCCTGGCTCACGGGCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270710 |
ORF Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001270710.1, NP_001257639.1 |
RefSeq Size | 1196 |
RefSeq ORF | 330 |
Locus ID | 11270 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (5) lacks two alternate in-frame exons in the coding region compared to variant 1. The resulting isoform (5) has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.