CD16b (FCGR3B) (NM_001271036) Human Untagged Clone

CAT#: SC330919

FCGR3B (untagged) - Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B), transcript variant 4


  "NM_001271036" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FCGR3B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FCGR3B
Synonyms CD16; CD16A; CD16b; FCG3; FCGR3; FCGR3A; FCR-10; FCRIII; FCRIIIb
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271036, the custom clone sequence may differ by one or more nucleotides


ATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAGG
ACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACAGTGGTTTCACAATGA
GAACCTCATCTCAAGCCAGGCCTCGAGCTACTTCATTGACGCTGCCACAGTCAACGACAGTGGAGAGTAC
AGGTGCCAGACAAACCTCTCCACCCTCAGTGACCCGGTGCAGCTAGAAGTCCATATCGGCTGGCTGTTGC
TCCAGGCCCCTCGGTGGGTGTTCAAGGAGGAAGACCCTATTCACCTGAGGTGTCACAGCTGGAAGAACAC
TGCTCTGCATAAGGTCACATATTTACAGAATGGCAAAGACAGGAAGTATTTTCATCATAATTCTGACTTC
CACATTCCAAAAGCCACACTCAAAGATAGCGGCTCCTACTTCTGCAGGGGGCTTGTTGGGAGTAAAAATG
TGTCTTCAGAGACTGTGAACATCACCATCACTCAAGGTTTGGCAGTGTCAACCATCTCATCATTCTCTCC
ACCTGGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTTTTTGCAGTGGACACAGGACTATATTTC
TCTGTGAAGACAAACATTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271036
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271036.1, NP_001257965.1
RefSeq Size 2260 bp
RefSeq ORF 651 bp
Locus ID 2215
Cytogenetics 1q23.3
Protein Families ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity, Systemic lupus erythematosus
Gene Summary 'The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. [provided by RefSeq, Aug 2012]'
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.