PYCR2 (NM_001271681) Human Untagged Clone

CAT#: SC330952

PYCR2 (untagged) - Homo sapiens pyrroline-5-carboxylate reductase family, member 2 (PYCR2), transcript variant 2


  "NM_001271681" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PYCR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PYCR2
Synonyms HLD10; P5CR2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271681, the custom clone sequence may differ by one or more nucleotides


ATGAGCGTGGGCTTCATCGGGGCCGGCCAGCTGGCCTATGCTCTGGCGCGGGGCTTCACGGCCGCAGGCA
TCCTGTCGGCTCACAAGATAATAGCCAGCTCCCCAGAAATGAACCTGCCCACGGTGTCCGCGCTCAGGAA
GATGGGTGTGAACCTGACACGCAGCAACAAGGAGACGGTGAAGCACAGCGACGTCCTGTTTCTGGCTGTG
AAGCCACATATCATCCCCTTCATCCTGGATGAGATTGGGGCCGACGTGCAAGCCAGACACATCGTGGTCT
CCTGTGCGGCTGGTGTCACCATCAGCTCTGTGGAGAAGGCATTCATGGCTCTGGACGCATTGGCTGATGG
TGGGGTGAAGATGGGTTTGCCACGGCGCCTGGCAATCCAACTCGGGGCCCAGGCTTTGCTGGGAGCTGCC
AAGATGCTGCTGGACTCGGAGCAGCATCCATGCCAGCTTAAGGACAATGTCTGCTCCCCTGGGGGAGCCA
CCATCCACGCCCTGCACTTTCTAGAGAGTGGGGGCTTCCGCTCTCTGCTCATCAATGCAGTTGAGGCCTC
CTGTATCCGAACACGAGAGCTACAGTCCATGGCCGACCAAGAAAAGATCTCCCCAGCTGCCCTTAAGAAG
ACCCTCTTAGACAGAGTGAAGCTGGAATCCCCCACAGTCTCCACACTGACCCCCTCCAGCCCAGGGAAGC
TCCTCACAAGAAGCCTGGCCCTGGGAGGCAAGAAGGACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001271681
ORF Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271681.1, NP_001258610.1
RefSeq Size 1549
RefSeq ORF 741
Locus ID 29920
Protein Pathways Arginine and proline metabolism, Metabolic pathways
Gene Summary This gene belongs to the pyrroline-5-carboxylate reductase family. The encoded mitochondrial protein catalyzes the conversion of pyrroline-5-carboxylate to proline, which is the last step in proline biosynthesis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.