SEC11A (NM_001271921) Human Untagged Clone

CAT#: SC331007

SEC11A (untagged) - Homo sapiens SEC11 homolog A (S. cerevisiae) (SEC11A), transcript variant 1


  "NM_001271921" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SEC11A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SEC11A
Synonyms 1810012E07Rik; SEC11L1; sid2895; SPC18; SPCS4A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271921, the custom clone sequence may differ by one or more nucleotides


ATGCTGTCTCTAGACTTTTTGGACGATGTGCGGCGGATGAACAAGCGGCAGCTCTATTATCAAGTCCTAA
ATTTTGGAATGATTGTCTCATCGGCACTAATGATCTGGAAGGGGTTAATGGTAATAACTGGAAGTGAAAG
TCCGATTGTAGTGGTGCTCAGGCAAAATGGGCATATCAAGTTTTTGACCAAAGGAGATAATAATGCGGTT
GATGACCGAGGCCTCTATAAACAAGGACAACATTGGCTAGAGAAAAAAGATGTTGTGGGGAGAGCCAGGG
GATTTGTTCCTTATATTGGAATTGTGACGATCCTCATGAATGACTATCCTAAATTTAAGTATGCAGTTCT
CTTTTTGCTGGGTTTATTCGTGCTGGTTCATCGTGAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001271921
ORF Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271921.1, NP_001258850.1
RefSeq Size 1274
RefSeq ORF 390
Locus ID 23478
Protein Families Druggable Genome, Protease, Transmembrane
Protein Pathways Protein export
Gene Summary This gene encodes a member of the peptidase S26B family. The encoded protein is an 18kDa subunit of the signal peptidase complex and has been linked to cell migration and invasion, gastric cancer and lymph node metastasis. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (1) represents the shortest transcript and encodes the shortest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.