HBLD1 (ISCA2) (NM_001272007) Human Untagged Clone

CAT#: SC331022

ISCA2 (untagged) - Homo sapiens iron-sulfur cluster assembly 2 (ISCA2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ISCA2
• Synonyms: c14_5557; HBLD1; ISA2; MMDS4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001272007, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCCGCCTGGGGGTCGTCCCTAACGGCCGCGACGCAGAGAGCGGTCACTCCCTGGCCGAGGGGCA
  GGCTCCTCACGGCCTCCCTGGGACCCCAGGCGCGTCGGGAGGCGTCGTCCTCCAGCCCCGAGGCCGGCGA
  AGGGCAGATCCGCCTCACAGACAGTTGCGTCCAGGGTATTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272007
• ORF Size: 183 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001272007.1, NP_001258936.1
• RefSeq Size: 972
• RefSeq ORF: 183
• Locus ID: 122961
• Gene Summary: The protein encoded by this gene is an A-type iron-sulfur cluster (ISC) protein found in mitochondria. The encoded protein appears to be involved in the maturation of mitochondrial iron-sulfur proteins. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.