MOK protein kinase (MOK) (NM_001272011) Human Untagged Clone

CAT#: SC331023

MOK (untagged) - Homo sapiens MOK protein kinase (MOK), transcript variant 2


  "NM_001272011" in other vectors (2)

Reconstitution Protocol

USD 390.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MOK
Synonyms RAGE; RAGE-1; RAGE1; STK30
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001272011, the custom clone sequence may differ by one or more nucleotides


ATGAAGAACTATAAAGCAATTGGCAAAATAGGAGAGGGAACGTTTTCTGAAGTTATGAAGATGCAAAGCC
TGAGAGATGGAAACTACTATGCATGTAAACAAATGAAGCAGCGCTTTGAAAGTGACAGAAAATCTGGTTC
TCTTGCACTAATATGTGAACTTATGGACATGAATATTTATGAGCTAATACGAGGGAGAAGATACCCATTA
TCAGAAAAAAAAATTATGCACTATATGTACCAGTTATGTAAGTCCCTGGATCATATTCACAGAAATGGAA
TATTTCACAGAGATGTAAAACCAGAAAATATACTAATAAAGCAGGATGTCCTGAAATTAGGGGACTTTGG
CTCCTGCCGGAGTGTCTATTCCAAGCAGCCGTACACGGAATACATCTCCACCCGCTGGTACCGGGCCCCG
GAGTGTCTCCTCACTGATGGGTTCTACACGTACAAGATGGACCTGTGGAGCGCCGGCTGTGTGTTCTACG
AGATCGCCAGTCTGCAGCCCCTCTTTCCTGGAGTAAATGAACTGGACCAAATCTCAAAAATCCACGATGT
CATCGGCACACCCGCTCAGAAGATCCTCACCAAGTTCAAACAGTCGAGAGCTATGAATTTTGATTTTCCT
TTTAAAAAGGGATCAGGAATACCTCTACTAACAACCAATTTGTCCCCACAATGCCTCTCCCTCCTGCACG
CAATGGTGGCCTATGATCCCGATGAGAGAATCGCCGCCCACCAGGCCCTGCAGCACCCCTACTTCCAAGA
ACAGAGGAAAACAGAGAAGCGGGCTCTGGGCAGCCACAGAAAAGCTGGCTTTCCGGAGCACCCTGTGGCA
CCGGAACCACTCAGTAACAGCTGCCAGATTTCCAAGGAGGGCAGAAAGCAGAAACAGTCCCTAAAGCAAG
AGGAGGACCGTCCCAAGAGACGAGGACCGGCCTATGTCATGGAACTGCCCAAACTAAAGCTTTCGGGAGT
GGTCAGACTGTCGTCTTACTCCAGCCCCACGCTGCAGTCCGTGCTTGGATCTGGAACAAATGGAAGAGTG
CCGGTGCTGAGACCCTTGAAGTGCATCCCTGCGAGCAAGAAGACAGATCCGCAGAAGGACCTTAAGCCTG
CCCCGCAGCAGTGTCGCCTGCCCACCATAGTGCGGAAAGGCGGAAGATAA


Restriction Sites SgfI-MluI     
ACCN NM_001272011
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001272011.1, NP_001258940.1
RefSeq Size 1888 bp
RefSeq ORF 1170 bp
Locus ID 5891
Cytogenetics 14q32.31
Protein Families Druggable Genome, Protein Kinase
Gene Summary 'This gene belongs to the MAP kinase superfamily. The gene was found to be regulated by caudal type transcription factor 2 (Cdx2) protein. The encoded protein, which is localized to epithelial cells in the intestinal crypt, may play a role in growth arrest and differentiation of cells of upper crypt and lower villus regions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]'
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.