LZTFL1 (NM_001276378) Human Untagged Clone

CAT#: SC331048

LZTFL1 (untagged) - Homo sapiens leucine zipper transcription factor-like 1 (LZTFL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LZTFL1
• Synonyms: BBS17
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001276378, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGTTTTGCTCGTTCAAAGAGAGGCTTGAGACTCAAAACTGTAGATTCCTGCTTCCAAGACCTCAAGG
  AGAGCAGGCTGGTGGAGGACACCTTCACCATAGATGAAGTCTCTGAAGTCCTCAATGGATTACAAGCTGT
  GGTTCATAGTGAGGTGGAATCTGAGCTCATCAACACTGCCTATACCAATGTGTTACTTCTGCGACAGCTG
  TTTGCACAAGCTGAGAAGTGGTATCTTAAGCTACAGACAGACATCTCTGAACTTGAAAACCGAGAATTAT
  TAGAACAAGTTGCAGAATTTGAAAAAGCAGAGATTACATCTTCAAACAAAAAGCCCATCTTAGATGTCAC
  AAAGCCAAAACTTGCTCCACTTAATGAAGGTGGAACAGCAGAACTCCTAAACAAGGAAATTTTAAGACTT
  CAAGAAGAGAATGAGAAATTGAAGTCAAGGTTGAAGACCATTGAAATACAGGCTACAAATGCACTGGATG
  AAAAGTCAAAACTAGAAAAAGCACTGCAAGATTTACAGCTTGATCAAGGAAATCAAAAGGATTTTATAAA
  GGCCCAAGACTTAAGTAACTTAGAAAACACTGTCGCTGCCTTAAAGAGTGAGTTTCAGAAGACACTTAAT
  GACAAGACAGAAAACCAGAAGTCACTGGAGGAGAATCTGGCGACAGCCAAGCACGATCTACTCAGGGTTC
  AGGAGCAGCTGCACATGGCTGAAAAGGAATTAGAAAAGAAATTTCAGCAAACAGCAGCTTATCGAAACAT
  GAAAGAGATTCTTACCAAGAAGAATGACCAAATCAAAGATCTGAGGAAAAGACTGGCACAATATGAACCT
  GAAGATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276378
• ORF Size: 849 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001276378.1, NP_001263307.1
• RefSeq Size: 4356
• RefSeq ORF: 849
• Locus ID: 54585
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a ubiquitously expressed protein that localizes to the cytoplasm. This protein interacts with Bardet-Biedl Syndrome (BBS) proteins and, through its interaction with BBS protein complexes, regulates protein trafficking to the ciliary membrane. Nonsense mutations in this gene cause a form of Bardet-Biedl Syndrome; a ciliopathy characterized in part by polydactyly, obesity, cognitive impairment, hypogonadism, and kidney failure. This gene may also function as a tumor suppressor; possibly by interacting with E-cadherin and the actin cytoskeleton and thereby regulating the transition of epithelial cells to mesenchymal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2013]
  Transcript Variant: This variant (2) contains a distinct 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream in-frame AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.