BCKDH kinase (BCKDK) (NM_001271926) Human Untagged Clone

CAT#: SC331120

BCKDK (untagged) - Homo sapiens branched chain ketoacid dehydrogenase kinase (BCKDK), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCKDK
• Synonyms: BCKDKD; BDK
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271926, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCCTGGCGTCGGTGCTGAGGAGCGGTCCCGGGGGCGGGCTTCCGCTCCGGCCCCTCCTGGGACCCG
  CACTCGCGCTCCGGGCCCGCTCGACGTCGGCCACCGACACACACCACGTGGAGATGGCTCGGGAGCGCTC
  CAAGACCGTCACCTCCTTTTACAACCAGTCGGCCATCGACGCGGCAGCGGAGAAGCCCTCAGTCCGCCTA
  ACGCCCACCATGATGCTCTACGCTGGCCGCTCTCAGGACGGCAGCCACCTTCTGAAAAGTGCTCGGTACC
  TGCAGCAAGAACTTCCAGTGAGGATTGCTCACCGCATCAAGGGCTTCCGCTGCCTTCCTTTCATCATTGG
  CTGCAACCCCACCATACTGCACGTGCATGAGCTATATATCCGTGCCTTCCAGAAGCTGACAGACTTCCCT
  CCGATCAAGGACCAGGCGGACGAGGCCCAGTACTGCCAGCTGGTGCGACAGCTGCTGGATGACCACAAGG
  ATGTGGTGACCCTCTTGGCAGAGGGCCTACGTGAGAGCCGGAAGCACATAGAGGATGAAAAGCTCGTCCG
  CTACTTCTTGGACAAGACGCTGACTTCGAGGCTTGGAATCCGCATGTTGGCCACGCATCACCTGGCGCTG
  CATGAGGACAAGCCTGACTTTGTCGGCATCATCTGTACTCGTCTCTCACCAAAGAAGATTATTGAGAAGT
  GGGTGGACTTTGCCAGACGCCTGTGTGAGCACAAGTATGGCAATGCGCCCCGTGTCCGCATCAATGGCCA
  TGTGGCTGCCCGGTTCCCCTTCATCCCTATGCCACTGGACTACATCCTGCCGGAGCTGCTCAAGAATGCC
  ATGAGGATCTCAGACCGTGGTGGAGGAATCGCTCACAAAGATCTGGACCGGGTCATGGACTACCACTTCA
  CTACTGCTGAGGCCAGCACACAGGACCCCCGGATCAGCCCCCTCTTTGGCCATCTGGACATGCATAGTGG
  CGCCCAGTCAGGACCCATGCACGGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271926
• ORF Size: 1008 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001271926.1, NP_001258855.1
• RefSeq Size: 2147
• RefSeq ORF: 1008
• Locus ID: 10295
• Protein Families: Druggable Genome, Protein Kinase
• Gene Summary: The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (3) retains an alternate exon in the 3' coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (c) is shorter at the C-terminus and lacks an alternate internal segment compared to isoform a.