GPSM1 (NM_001200003) Human Untagged Clone

CAT#: SC331397

GPSM1 (untagged) - Homo sapiens G-protein signaling modulator 1 (GPSM1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GPSM1
• Synonyms: AGS3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001200003, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACGACCAGCGTTGTCCCCTGGACGATGGCCAGGCCGGGGCTGCCGAGGCCACGGCCGCCCCCACCC
  TGGAGGACAGGATCGCCCAGCCCTCGATGACGGCCTCGCCCCAGACCGAGGAATTCTTCGACCTCATCGC
  CAGCTCCCAGAGCCGCCGGCTGGACGACCAGCGGGCCAGCGTGGGCAGCCTGCCGGGGCTGCGAATCACC
  CACAGCAATGCAGGGCACCTCCGAGGCCACGGCGAGCCCCAGGAGCCGGGGGACGACTTCTTCAACATGC
  TCATCAAGTACCAGTCCTCCAGGATCGATGACCAGCGCTGCCCGCCACCTGACGTACTGCCCCGGGGCCC
  TACCATGCCGGACGAGGACTTCTTCAGCCTCATTCAGAGGGTGCAGGCTAAGCGCATGGACGAGCAGCGG
  GTGGACCTCGCCGGGGGCCCGGAGCAGGGGGCAGGCGGCCCGCCCGAGCCCCAGCAGCAGTGCCAGCCTG
  GTGCGAGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001200003
• ORF Size: 501 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001200003.1, NP_001186932.1
• RefSeq Size: 2199
• RefSeq ORF: 501
• Locus ID: 26086
• Gene Summary: G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks multiple 5' coding exons, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c, also known as AGS3-SHORT) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode the same isoform (c).