Mad (MXD1) (NM_001202514) Human Untagged Clone

CAT#: SC331464

MXD1 (untagged) - Homo sapiens MAX dimerization protein 1 (MXD1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MXD1
• Synonyms: BHLHC58; MAD; MAD1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001202514, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCGGCGGTTCGGATGAACATCCAGATGCTGCTGGAGGCGGCCGACTATCTGGAGCGGCGGGAGA
  GAGAAGCTGAACATGGTTATGCCTCCATGTTACCATACAATAACAAGGACAGAGATGCCTTAAAACGGAG
  GAACAAATCCAAAAAGAATAACAGCAGTAGCAGACGGGCTCATCTTCGCTTGTGCCTGGAGAAGTTGAAG
  GGGCTGGTGCCACTTGGACCCGAATCAAGTCGACACACTACGTTGAGTTTATTAACAAAAGCCAAATTGC
  ACATAAAGAAACTTGAAGATTGTGACAGAAAAGCCGTTCACCAAATCGACCAGCTTCAGCGAGAGCAGCG
  ACACCTGAAGAGGCAGCTGGAGAAGCTGGGCATTGAGAGGATCCGGATGGACAGCATCGGCTCCACCGTC
  TCCTCGGAGCGCTCCGACTCCGACAGGGAAGAAATCGACGTTGACGTGGAGAGCACGGACTATCTCACAG
  GTGATCTGGACTGGAGCAGCAGCAGTGTGAGCGACTCTGACGAGCGGGGCAGCATGCAGAGCCTCGGCAG
  TGATGAGGGCTATTCCAGCACCAGCATCAAGAGAATAAAGCTGCAGGACAGTCACAAGGCGTGTCTTGGT
  CTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001202514
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001202514.1, NP_001189443.1
• RefSeq Size: 5600 bp
• RefSeq ORF: 636 bp
• Locus ID: 4084
• Cytogenetics: 2p13.3
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene encodes a member of the MYC/MAX/MAD network of basic helix-loop-helix leucine zipper transcription factors. The MYC/MAX/MAD transcription factors mediate cellular proliferation, differentiation and apoptosis. The encoded protein antagonizes MYC-mediated transcriptional activation of target genes by competing for the binding partner MAX and recruiting repressor complexes containing histone deacetylases. Mutations in this gene may play a role in acute leukemia, and the encoded protein is a potential tumor suppressor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (3) lacks an exon in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.