GABA A Receptor alpha 4 (GABRA4) (NM_001204267) Human Untagged Clone

CAT#: SC331539

GABRA4 (untagged) - Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 4 (GABRA4), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GABRA4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204267, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTGCAAAGATGGTTTCTGCCAAGAAGTTTAAACGAATCCCCAGGACAGAACCAAAAGGAGGAGAAAT
  TGTGCACAGAAAATTTCACCCGCATCCTGGACAGTTTGCTCGATGGTTATGACAACAGGCTGCGTCCTGG
  ATTTGGGGGTCCTGTTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTT
  GAAATGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATTAAAATATGACGGCC
  CCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAGTGTGGACCCCTGATACTTTCTTCAGGAA
  TGGAAAGAAATCTGTCTCACATAATATGACAGCTCCAAATAAGCTTTTTAGAATTATGAGAAATGGTACT
  ATTTTATACACAATGAGACTCACCATAAGTGCGGAGTGTCCCATGAGATTGGTGGATTTTCCCATGGATG
  GTCATGCATGCCCTTTGAAATTCGGGAGTTATGCCTATCCAAAGAGTGAGATGATCTATACCTGGACAAA
  AGGTCCTGAGAAATCAGTTGAAGTTCCGAAGGAGTCTTCCAGCTTAGTTCAATATGATTTGATTGGGCAA
  ACCGTATCAAGTGAAACCATCAAATCAATTACGGGAATAACAACTGTCCTCACCATGACCACACTAAGCA
  TCAGTGCACGACATTCTTTGCCCAAAGTGTCCTATGCTACCGCCATGGACTGGTTCATAGCTGTCTGCTT
  TGCTTTTGTATTTTCGGCCCTTATCGAGTTTGCTGCTGTCAACTATTTCACCAATATTCAAATGGAAAAA
  GCCAAAAGGAAGACATCAAAGCCCCCTCAGGAAGTTCCCGCTGCTCCAGTGCAGAGAGAGAAGCATCCTG
  AAGCCCCTCTGCAGAATACAAATGCCAATTTGAACATGAGAAAAAGAACAAATGCTTTGGTTCACTCTGA
  ATCTGATGTTGGCAACAGAACTGAGGTGGGAAACCATTCAAGCAAATCTTCCACAGTTGTTCAAGAATCT
  TCTAAAGGCACACCTCGGTCTTACTTAGCTTCCAGTCCAAACCCATTCAGCCGTGCAAATGCAGCTGAAA
  CCATATCTGCAGCAAGAGCACTTCCATCTGCTTCTCCTACTTCTATCCGAACTGGATATATGCCTCGAAA
  GGCTTCAGTTGGATCTGCTTCTACTCGTCACGTGTTTGGATCAAGACTGCAGAGGATAAAGACCACAGTT
  AATACCATAGGGGCTACTGGGAAGTTGTCAGCTACTCCTCCTCCATCGGCTCCACCACCTTCTGGATCTG
  GCACAAGTAAAATAGACAAATATGCCCGTATTCTCTTTCCAGTCACATTTGGGGCATTTAACATGGTTTA
  TTGGGTTGTTTATTTATCTAAGGACACTATGGAGAAATCAGAAAGTCTAATGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204267
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204267.1, NP_001191196.1
• RefSeq Size: 10864 bp
• RefSeq ORF: 1455 bp
• Locus ID: 2557
• Cytogenetics: 4p12
• Protein Families: Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: 'Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. This gene encodes subunit alpha-4, which is involved in the etiology of autism and eventually increases autism risk through interaction with another subunit, gamma-aminobutyric acid receptor beta-1 (GABRB1). Alternatively spliced transcript variants encoding different isoforms have been found in this gene.[provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (3) lacks a segment in the first splice junction, resulting in an upstream AUG start codon, and lacks an in-frame exon in the middle region, as compared to variant 1. The resulting isoform (3) has a shorter and different N-terminus and lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.