HLA DP (HLA-DPA1) (NM_001242524) Human Untagged Clone
CAT#: SC331822
HLA (untagged) - Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), transcript variant 2
"NM_001242524" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HLA-DPA1 |
Synonyms | DP(W3); DP(W4); DPA1; HLA-DP1A; HLADP; HLASB; PLT1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001242524, the custom clone sequence may differ by one or more nucleotides
ATGCGCCCTGAAGACAGAATGTTCCATATCAGAGCTGTGATCTTGAGAGCCCTCTCCTTGGCTTTCCTGC TGAGTCTCCGAGGAGCTGGGGCCATCAAGGCGGACCATGTGTCAACTTATGCCGCGTTTGTACAGACGCA TAGACCAACAGGGGAGTTTATGTTTGAATTTGATGAAGATGAGATGTTCTATGTGGATCTGGACAAGAAG GAGACCGTCTGGCATCTGGAGGAGTTTGGCCAAGCCTTTTCCTTTGAGGCTCAGGGCGGGCTGGCTAACA TTGCTATATTGAACAACAACTTGAATACCTTGATCCAGCGTTCCAACCACACTCAGGCCACCAACGATCC CCCTGAGGTGACCGTGTTTCCCAAGGAGCCTGTGGAGCTGGGCCAGCCCAACACCCTCATCTGCCACATT GACAAGTTCTTCCCACCAGTGCTCAACGTCACGTGGCTGTGCAACGGGGAGCTGGTCACTGAGGGTGTCG CTGAGAGCCTCTTCCTGCCCAGAACAGATTACAGCTTCCACAAGTTCCATTACCTGACCTTTGTGCCCTC AGCAGAGGACTTCTATGACTGCAGGGTGGAGCACTGGGGCTTGGACCAGCCGCTCCTCAAGCACTGGGAG GCCCAAGAGCCAATCCAGATGCCTGAGACAACGGAGACTGTGCTCTGTGCCCTGGGCCTGGTGCTGGGCC TAGTCGGCATCATCGTGGGCACCGTCCTCATCATAAAGTCTCTGCGTTCTGGCCATGACCCCCGGGCCCA GGGGACCCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242524 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242524.1, NP_001229453.1 |
RefSeq Size | 1788 bp |
RefSeq ORF | 783 bp |
Locus ID | 3113 |
Cytogenetics | 6p21.32 |
Protein Families | Transmembrane |
Protein Pathways | Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis |
Gene Summary | 'HLA-DPA1 belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta (DPB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233577 | HLA (Myc-DDK tagged) - Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), transcript variant 2 |
USD 420.00 |
|
RG233577 | HLA (GFP-tagged) - Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review