ELOVL5 (NM_001242830) Human Untagged Clone

CAT#: SC331889

ELOVL5 (untagged) - Homo sapiens ELOVL fatty acid elongase 5 (ELOVL5), transcript variant 3


  "NM_001242830" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ELOVL5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ELOVL5
Synonyms dJ483K16.1; HELO1; SCA38
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001242830, the custom clone sequence may differ by one or more nucleotides


ATGGAACATTTTGATGCATCACTTAGTACCTATTTCAAGGCATTGCTAGGCCCTCGAGATACTAGAGTAA
AAGGATGGTTTCTTCTGGACAATTATATACCCACATTTATCTGCTCTGTCATATATTTACTAATTGTATG
GCTGGGACCAAAATACATGAGGAATAAACAGCCATTCTCTTGCCGGGGGATTTTAGTGGTGTATAACCTT
GGACTCACACTGCTGTCTCTGTATATGTTCTGTGAGTTAGTAACAGGAGTATGGGAAGGCAAATACAACT
TCTTCTGTCAGGGCACACGCACCGCAGGAGAATCAGATATGAAGATTATCCGTGTCCTCTGGTGGTACTA
CTTCTCCAAACTCATAGAATTTATGGACACTTTCTTCTTCATCCTGCGCAAGAACAACCACCAGATCACG
GTCCTGCACGTCTACCACCATGCCTCGATGCTGAACATCTGGTGGTTTGTGATGAACTGGGTCCCCTGCG
GCCACTCTTCAGTTTGTGCTGACAATCATCCAGACCAGCTGCGGGGTCATCTGGCCGTGCACATTCCCTC
TTGGTTGGTTGTATTTCCAGATTGGATACATGATTTCCCTGATTGCTCTCTTCACAAACTTCTACATTCA
GACCTACAACAAGAAAGGGGCCTCCCGAAGGAAAGACCACCTGAAGGACCACCAGAATGGGTCCATGGCT
GCTGTGAATGGACACACCAACAGCTTTTCACCCCTGGAAAACAATGTGAAGCCAAGGAAGCTGCGGAAGG
ATTGAAGTCAAAGAATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001242830
ORF Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001242830.1, NP_001229759.1
RefSeq Size 2913
RefSeq ORF 789
Locus ID 60481
Protein Families Transmembrane
Protein Pathways Biosynthesis of unsaturated fatty acids
Gene Summary This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (3) lacks an internal coding exon, which causes a frame-shift compared to variant 1. The resulting isoform (3) is shorter with a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.