PTCRA (NM_001243169) Human Untagged Clone

CAT#: SC331963

PTCRA (untagged) - Homo sapiens pre T-cell antigen receptor alpha (PTCRA), transcript variant 3


  "NM_001243169" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PTCRA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTCRA
Synonyms PT-ALPHA; PTA
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243169, the custom clone sequence may differ by one or more nucleotides


ATGGCCGGTACATGGCTGCTACTTCTCCTGGCCCTTGGGTGTCCAGCCCTACCCACAGGTCCTGTTTCCT
TCCCTTCCTCACCAGAGGCTGCCACAACAGGCCCCATCTGGTTCTCAGCCGGCAATGGCAGTGCACTGGA
TGCCTTCACCTATGGCCCTTCCCCAGCAACGGATGGCACCTGGACCAACTTGGCCCATCTCTCCCTGCCT
TCTGAGGAGCTGGCATCCTGGGAGCCTTTGGTCTGCCACACTGGGCCTGGGGCTGAGGGTCACAGCAGGA
GTACACAGCCCATGCATCTGTCAGGAGAGGCTTCTACAGCCAGGACCTGCCCCCAGGAGCCTCTCAGGGG
GACACCGGGTGGGGCGCTGTGGCTGGGGGTCCTGCGGCTGCTGCTCTTCAAGCTGCTGCTGTTTGACCTG
CTCCTGACCTGCAGCTGCCTGTGCGACCCCGCGGGCCCGCTGCCTTCCCCCGCAACCACCACCCGCCTGC
GAGCCCTCGGCTCCCATCGACTGCACCCGGCCACGGAGACTGGGGGACGAGAGGCCACCAGCTCACCCAG
ACCCCAGCCTCGGGACCGCCGCTGGGGTGACACCCCTCCGGGTCGGAAGCCCGGGAGCCCAGTATGGGGG
GAAGGGTCTTACCTCAGCAGTTACCCCACTTGCCCAGCACAGGCCTGGTGCTCAAGATCTGCCCTCAGGG
CTCCTTCCTCCAGTCTTGGAGCATTTTTTGCAGGTGACCTGCCTCCTCCTCTGCAGGCTGGAGCTGCCTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001243169
ORF Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243169.1, NP_001230098.1
RefSeq Size 1022
RefSeq ORF 771
Locus ID 171558
Protein Families Transmembrane
Protein Pathways Notch signaling pathway
Gene Summary The protein encoded by this gene is a single-pass type I membrane protein that is found in immmature but not mature T-cells. Along with TCRB and CD3 complex, the encoded protein forms the pre-T-cell receptor complex, which regulates early T-cell development. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (3) uses alternate in-frame splice junctions at the 5' ends of two exons and contains an alternate in-frame exon compared to variant 1. The resulting isoform (3) contains an alternate internal segment but lacks two others compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.