Plunc (BPIFA1) (NM_001243193) Human Untagged Clone

CAT#: SC331968

BPIFA1 (untagged) - Homo sapiens BPI fold containing family A, member 1 (BPIFA1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BPIFA1
• Synonyms: bA49G10.5; LUNX; NASG; PLUNC; SPLUNC1; SPURT
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243193, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTCAAACTGGGGGCCTCATTGTCTTCTACGGGCTGTTAGCCCAGACCATGGCCCAGTTTGGAGGCC
  TGCCCGTGCCCCTGGACCAGACCCTGCCCTTGAATGTGAATCCAGCCCTGCCCTTGAGTCCCACAGGTCT
  TGCAGGAAGCTTGACAAATGCCCTCAGCAATGGCCTGCTGTCTGGGGGCCTGTTGGGCATTCTGGAAAAC
  CTTCCGCTCCTGGACATCCTGAAGCCTGGAGGAGGTACTTCTGGTGGCCTCCTTGGGGGACTGCTTGGAA
  AAGTGACGTCAGTGATTCCTGGCCTGAACAACATCATTGACATAAAGGTCACTGACCCCCAGCTGCTGGA
  ACTTGGCCTTGTGCAGAGCCCTGATGGCCACCGTCTCTATGTCACCATCCCTCTCGGCATAAAGCTCCAA
  GTGAATACGCCCCTGGTCGGTGCAAGTCTGTTGAGGCTGGCTGTGAAGCTGGACATCACTGCAGAAATCT
  TAGCTGTGAGAGATAAGCAGGAGAGGATCCACCTGGTCCTTGGTGACTGCACCCATTCCCCTGGAAGCCT
  GCAAATTTCTCTGCTTGATGGACTTGGCCCCCTCCCCATTCAAGGTCTTCTGGACAGCCTCACAGGGATC
  TTGAATAAAGTCCTGCCTGAGTTGGTTCAGGGCAACGTGTGCCCTCTGGTCAATGAGGTTCTCAGAGGCT
  TGGACATCACCCTGGTGCATGACATTGTTAACATGCTGATCCACGGACTACAGTTTGTCATCAAGGTCTA
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243193
• ORF Size: 771 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243193.1, NP_001230122.1
• RefSeq Size: 1074
• RefSeq ORF: 771
• Locus ID: 51297
• Protein Families: Secreted Protein
• Gene Summary: This gene is the human homolog of murine plunc, and like the mouse gene, is specifically expressed in the upper airways and nasopharyngeal regions. The encoded antimicrobial protein displays antibacterial activity against Gram-negative bacteria. It is thought to be involved in inflammatory responses to irritants in the upper airways and may also serve as a potential molecular marker for detection of micrometastasis in non-small-cell lung cancer. Multiple transcript variants resulting from alternative splicing in the 3' UTR have been detected, but the full-length nature of only three are known. [provided by RefSeq, Aug 2014]
  Transcript Variant: This variant (3) differs in the 3' UTR compared to variant 2. All three variants encode the same protein.