ZNF323 (ZSCAN31) (NM_001243242) Human Untagged Clone

CAT#: SC331974

ZSCAN31 (untagged) - Homo sapiens zinc finger and SCAN domain containing 31 (ZSCAN31), transcript variant 8


  "NM_001243242" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZSCAN31"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZSCAN31
Synonyms ZNF20-Lp; ZNF310P; ZNF323
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243242, the custom clone sequence may differ by one or more nucleotides


ATGGTGACACAGCTCAGATATGAATCTTTTTGCCTCCACCAATTTCAAGAACAAGATGGTGAAAGTATAC
CTGAGAACCAGGAGTTGGCATCAAAGCAAGAAATCTTAAAAGAAATGGAACATTTGGGGGATAGCAAACT
CCAAAGAGATGTATCTTTGGATTCTAAGTACAGAGAAACTTGTAAACGAGACAGCAAGGCAGAAAAGCAG
CAGGCACATTCCACTGGAGAGAGACGCCACAGGTGCAATGAATGTGGGAAAAGCTTCACTAAGAGTTCAG
TACTCATTGAGCACCAGAGAATCCACACTGGGGAGAAGCCATATGAATGTGAAGAATGTGGGAAGGCCTT
CAGCCGGAGGTCAAGCCTGAATGAACATCGGCGGAGCCACACTGGAGAGAAACCCTATCAATGTAAGGAG
TGTGGGAAAGCCTTCAGTGCCAGCAATGGCCTCACTCGACACAGAAGAATCCACACAGGGGAAAAACCAT
ATGAATGCAAAGTGTGTGGGAAGGCTTTCCTCCTCAGCTCATGCCTTGTTCAGCATCAGAGGATACACAC
TGGAGAGAAGCGCTATCAGTGTCGTGAGTGTGGCAAAGCCTTCATTCAGAATGCAGGGCTTTTCCAGCAT
CTCCGAGTCCACACTGGTGAGAAACCCTATCAGTGCAGTCAGTGCAGTAAACTCTTTAGTAAGCGGACAC
TTCTTAAGAAACATCAGAAAATCCACACTGGAGAGAGACCATAA


Restriction Sites SgfI-MluI     
ACCN NM_001243242
ORF Size 744 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243242.1, NP_001230171.1
RefSeq Size 2690
RefSeq ORF 744
Locus ID 64288
Protein Families Transcription Factors
Gene Summary This gene encodes a protein containing multiple C2H2-type zinc finger motifs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream, in-frame start codon, compared to variant 1. Variants 5, 6 and 8 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.