MAPKAP Kinase 3 (MAPKAPK3) (NM_001243926) Human Untagged Clone
CAT#: SC332054
MAPKAPK3 (untagged) - Homo sapiens mitogen-activated protein kinase-activated protein kinase 3 (MAPKAPK3), transcript variant 1
"NM_001243926" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAPKAPK3 |
Synonyms | 3PK; MAPKAP-K3; MAPKAP3; MAPKAPK-3; MDPT3; MK-3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243926, the custom clone sequence may differ by one or more nucleotides
ATGGATGGTGAAACAGCAGAGGAGCAGGGGGGCCCTGTGCCCCCGCCAGTTGCACCCGGCGGACCCGGCT TGGGCGGTGCTCCGGGGGGGCGGCGGGAGCCCAAGAAGTACGCAGTGACCGACGACTACCAGTTGTCCAA GCAGGTGCTGGGCCTGGGTGTGAACGGCAAAGTGCTGGAGTGCTTCCATCGGCGCACTGGACAGAAGTGT GCCCTGAAGCTCCTGTATGACAGCCCCAAGGCCCGGCAGGAGGTAGACCATCACTGGCAGGCTTCTGGCG GCCCCCATATTGTCTGCATCCTGGATGTGTATGAGAACATGCACCATGGCAAGCGCTGTCTCCTCATCAT CATGGAATGCATGGAAGGTGGTGAGTTGTTCAGCAGGATTCAGGAGCGTGGCGACCAGGCTTTCACTGAG AGAGAAGCTGCAGAGATAATGCGGGATATTGGCACTGCCATCCAGTTTCTGCACAGCCATAACATTGCCC ACCGAGATGTCAAGCCTGAAAACCTACTCTACACATCTAAGGAGAAAGACGCAGTGCTTAAGCTCACCGA TTTTGGCTTTGCTAAGGAGACCACCCAAAATGCCCTGCAGACACCCTGCTATACTCCCTATTATGTGGCC CCTGAGGTCCTGGGTCCAGAGAAGTATGACAAGTCATGTGACATGTGGTCCCTGGGTGTCATCATGTACA TCCTCCTTTGTGGCTTCCCACCCTTCTACTCCAACACGGGCCAGGCCATCTCCCCGGGGATGAAGAGGAG GATTCGCCTGGGCCAGTACGGCTTCCCCAATCCTGAGTGGTCAGAAGTCTCTGAGGATGCCAAGCAGCTG ATCCGCCTCCTGTTGAAGACAGACCCCACAGAGAGGCTGACCATCACTCAGTTCATGAACCACCCCTGGA TCAACCAATCGATGGTAGTGCCACAGACCCCACTCCACACGGCCCGAGTGCTGCAGGAGGACAAAGACCA CTGGGACGAAGTCAAGGAGGAGATGACCAGTGCCTTGGCCACTATGCGGGTAGACTACGACCAGGTGAAG ATCAAGGACCTGAAGACCTCTAACAACCGGCTCCTCAACAAGAGGAGAAAAAAGCAGGCAGGCAGCTCCT CTGCCTCACAGGGCTGCAACAACCAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243926 |
ORF Size | 1149 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243926.1, NP_001230855.1 |
RefSeq Size | 3047 |
RefSeq ORF | 1149 |
Locus ID | 7867 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | MAPK signaling pathway, VEGF signaling pathway |
Gene Summary | This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233934 | MAPKAPK3 (Myc-DDK tagged) - Homo sapiens mitogen-activated protein kinase-activated protein kinase 3 (MAPKAPK3), transcript variant 1 |
USD 420.00 |
|
RG233934 | MAPKAPK3 (GFP-tagged) - Homo sapiens mitogen-activated protein kinase-activated protein kinase 3 (MAPKAPK3), transcript variant 1 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review