PRPSAP2 (NM_001243940) Human Untagged Clone

CAT#: SC332055

PRPSAP2 (untagged) - Homo sapiens phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRPSAP2
• Synonyms: PAP41
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243940, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTTGTGTGACGCCACCTGAATTAGAAACCAAGATGAACATAACCAAAGGTGGTCTGGTGTTGTTTT
  CAGCAAACTCGAATTCATCATGTATGGAGCTATCAAAGAAAATTGCAGAGCGGCTAGGGGTGGAGATGGG
  CAAAGTGCAGGTTTACCAGGAACCTAACAGAGAAACAAGAGTACAAATTCAAGAGTCTGTGAGGGGAAAA
  GATGTTTTCATCATCCAAACTGTTTCGAAGGACGTGAACACCACCATCATGGAGCTCCTGATCATGGTGT
  ATGCATGTAAGACCTCTTGTGCCAAGAGCATCATTGGCGTGATACCCTACTTTCCTTACAGCAAGCAGTG
  CAAGATGAGAAAAAGAGGCTCCATTGTCTCTAAATTGCTGGCTTCCATGATGTGCAAAGCTGGTCTAACT
  CATCTTATTACTATGGATTTACACCAGAAGGAAATTCAGGGCTTCTTCAATATTCCTGTTGACAATTTAA
  GAGCATCTCCCTTCTTATTACAGTATATTCAAGAAGAGATCCCAGATTACAGGAATGCAGTAATCGTGGC
  CAAGTCTCCAGCCTCGGCGAAGAGGGCACAGTCTTTTGCTGAGCGCCTGCGCCTGGGAATTGCAGTGATT
  CATGGAGAGGCGCAGGATGCCGAGTCGGACTTGGTGGATGGACGGCATTCCCCACCCATGGTCAGAAGTG
  TGGCTGCCATCCACCCCAGCCTGGAGATCCCCATGCTGATTCCTAAAGAAAAGCCCCCAATCACGGTTGT
  GGGTGATGTTGGAGGAAGGATTGCCATCATCGTGGTGGTGGTCACCAATACAATTCCACATGAAGTCCAG
  AAGCTCCAGTGCCCCAAGATTAAAACTGTGGATATCAGCATGATCCTTTCAGAGGCGATCCGTCGGATCC
  ACAATGGGGAGTCCATGTCCTACCTTTTCAGAAACATAGGCTTAGATGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243940
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243940.1, NP_001230869.1
• RefSeq Size: 1680 bp
• RefSeq ORF: 963 bp
• Locus ID: 5636
• Cytogenetics: 17p11.2
• Protein Families: Druggable Genome
• Gene Summary: 'This gene encodes a protein that associates with the enzyme phosphoribosylpyrophosphate synthetase (PRS). PRS catalyzes the formation of phosphoribosylpyrophosphate which is a substrate for synthesis of purine and pyrimidine nucleotides, histidine, tryptophan and NAD. PRS exists as a complex with two catalytic subunits and two associated subunits. This gene encodes a non-catalytic associated subunit of PRS. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]'
  Transcript Variant: This variant (3) has a shorter 5' UTR and lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1.